Chamq sybr qpcr master mix without rox

Manufactured by Vazyme

Sourced in China, United States

ChamQ SYBR qPCR Master Mix (without ROX) is a high-performance, ready-to-use reagent for real-time quantitative PCR (qPCR) experiments. It contains the necessary components for efficient DNA amplification and detection using SYBR Green chemistry, excluding the ROX passive reference dye.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (4 mentions) Nanodrop nd 2000, by Thermo Fisher Scientific (2 mentions) Lc 96 qpcr system, by Roche (2 mentions) Hiscript 2 q rt supermix for qpcr kit, by Vazyme (2 mentions) Hiscript 2 q select rt supermix for qpcr gdna wiper, by Vazyme (1 mentions) Trizol, by Takara Bio (1 mentions) One step primescript rt pcr kit, by Takara Bio (1 mentions) Prism 6, by GraphPad (1 mentions) Hiscript 2 q select rt supermix, by Vazyme (1 mentions) Rnaiso plus, by Takara Bio (1 mentions) Trizol universal reagent, by Tiangen Biotech (1 mentions) All in one rt mastermix, by Applied Biological Materials (1 mentions) Mirna 1st strand cdna synthesis kit, by Vazyme (1 mentions) Mirna 1st strand cdna synthesis kit, by Accurate Biology (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Hiscript 3 all in one rt supermix perfect for qpcr, by Vazyme (1 mentions) Mirna universal sybr qpcr master mix, by Vazyme (1 mentions) Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions) Cfx96 real time detection system, by Bio-Rad (1 mentions) Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)

Spelling variants of this product

ChamQ SYBR qPCR Master Mix (906 citations) SYBR qPCR Mix (29 citations) SYBR Master Mix (26 citations) ChamQ SYBR Master Mix (17 citations) QPCR Master Mix (16 citations) ChamQ SYBR qPCR Mix (5 citations) ChamQ SYBR Color qPCR Master Mix (Without ROX) (2 citations)

13 protocols using chamq sybr qpcr master mix without rox

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA of ICP1 cells was extracted using Trizol (Takara, Dalian, China), and reverse transcription was performed using HiScript II Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme) according to the manufacturer’s instructions. qRT-PCR was performed using ChamQTM SYBR qPCR Master Mix (without ROX) (Vazyme) according to the manufacturer’s instructions. Each 20 μL reaction mixture contained 10 μL 2× ChamQ SYBR qPCR Master Mix, 2 μL cDNA template, 0.4 μL upstream and downstream primers (10 μM), and 2 μL ddH
₂O. The reaction program was as follows: 95°C for 30 s; 40 cycles of 95°C for 10 s and 60°C for 30 s. Three replicates were set for each sample.
NONO or
TBP was used as the internal reference gene, and the original
Ct values were converted into the relative expression levels of the genes using the 2
^–∆∆Ct method. The primers used for qPCR are listed in
Supplementary Table S1. RNA isolation and qRT-PCR were independently repeated three times, with three replicates.

Tan M., Xu H., Li J., Jia Z., Zhang X., Shao S., Zhang W., Wang W, & Sun Y. (2023). PU.1 interacts with KLF7 to suppress differentiation and promote proliferation in chicken preadipocytes: Role of PU.1 and KLF7 in chicken preadipocytes. Acta Biochimica et Biophysica Sinica, 55(1), 143-153.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Wasp Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

During the lifespan experiments, we carried out parallel sampling of wasps for qPCR analysis. The PrimeScript™ One Step RT-PCR Kit (Takara, Japan) was utilized to synthesize cDNA. For qPCR reactions, ChamQTM SYBR qPCRMaster Mix (Without ROX) (Vazyme Biotech Co., Ltd.) was employed. The qPCR reaction volume was 25 µL with 10 ng cDNA as the template. Each sample was subjected to three biologically independent replicates. Initially, we ensured the specificity of each primer pair. At the end of each qPCR reaction, we included a melt curve ranging from 60°C to 95°C. We performed qPCR for templates with serial dilutions ranging from 10 to 100,000, respectively, to determine the efficiency of the primers and calculate their efficiency values. We selected appropriate primers for gene expression profile determinations based on the specificity and efficiency verifications. 18S ribosome RNA (18S) was used as the reference gene. To calculate relative mRNA expression levels, we used the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). We plotted the obtained data using GraphPad Prism6 for Mac, where the relative expression levels of genes were presented as means ± SEM. The statistical analysis was performed using two-way ANOVA, and differences were considered significant when p < 0.05.

Lao S., Xiong S., Fang Q, & Ye G. (2023). Identification and functional analysis of αB-crystallins in Pteromalus puparum. Frontiers in Physiology, 14, 1214835.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from ICP1 cells using RNAiso Plus (Takara Bio, Dalian, China). The RNA was reverse-transcribed into cDNA using HiScript® II Q Select RT SuperMix (Vazyme). The cDNA was diluted 3-fold and used as a template for RT-qPCR using ChamQ^TM SYBR® qPCR Master Mix (Without ROX) (Vazyme) as per the manufacturer's instructions. Relative mRNA levels were calculated using the 2^–∆∆Ct method (Livak and Schmittgen, 2001 (link)) and normalized to that of the endogenous reference gene TBP (NM_205103) or NONO (NM_001031532.1). Three independent experiments were performed. The primers are listed in Table S1.

Jia Z., Jin Z., Li M., Zhang X., Peng M., Zhang S., Tan M., Yang Q., Wang W, & Sun Y. (2024). E2F transcription factor 5, a new regulator in adipogenesis to mediate the role of Krüppel-like factor 7 in chicken preadipocyte differentiation and proliferation. Poultry Science, 103(6), 103728.

+ Open protocol

+ Expand

Quantifying circRNA Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturers’ instructions, total RNA was obtained from cells or tissues by TRIzol reagent (Invitrogen). The concentration of RNA was determined by NanoDrop ND2000 (Thermo Scientific.) to examine the purity and quantify of extracted total RNA. HiScript II Q RT SuperMix for qPCR Kit (Vazyme Biotech Co., Ltd) was used for total RNA reverse transcription. Primers used for RT‐qPCR were synthesized by Tsingke Biological Technology (Nanjing). ChamQ SYBR qPCR Master Mix (without ROX) (Vazyme Biotech Co., Ltd) was used for RT‐qPCR according to the manufacturer's instructions, in a Roche LC 96 qPCR system (Roche). The PCR reaction program started at 95°C for 2 minutes, 40 cycles for 95°C for 10 seconds followed by 60°C for 30 seconds. GAPDH or U6 was the internal reference of measuring qPCR results. Target gene relative levels were measured by 2^−ΔΔCT method. The RT‐qPCR primers of circSMC3 were Forward: 5'‐CAGATCGAGACCCAGCAAA‐3'; Reverse: 5'‐GCAGGTTTTCATTGAGCTTT‐3'.

Xia T., Pan Z, & Zhang J. (2020). CircSMC3 regulates gastric cancer tumorigenesis by targeting miR‐4720‐3p/TJP1 axis. Cancer Medicine, 9(12), 4299-4309.

+ Open protocol

+ Expand

Quantitative PCR Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the tissues or cultured cells was extracted with TRIzol Universal Reagent (Tiangen, China). One microgram of RNA was reverse-transcribed into cDNA using 5× All-In-One RT MasterMix (Applied Biological Materials Inc., Canada). Individual qPCR mixes were made according to the recommendations of the manufacturer of ChamQ SYBR® qPCR Master Mix (Without ROX) (Vazyme, China). Differences among the target gene expression levels were estimated by the ΔΔC_t method, and target gene expression was normalized by GAPDH expression. The values are the mean ± SEM. The primers used in this study are listed in Supplementary Table S1.

Lv H., Nan Z., Jiang P., Wang Z., Song M., Ding H., Liu D., Zhao G., Zheng Y, & Hu Y. (2019). Vascular endothelial growth factor 165 inhibits pro-fibrotic differentiation of stromal cells via the DLL4/Notch4/smad7 pathway. Cell Death & Disease, 10(9), 681.

+ Open protocol

+ Expand

qPCR Analysis of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the samples using TRIzol (Invitrogen, USA) according to the manufacturer's protocol. The miRNA 1st strand cDNA synthesis kit (Accurate Biology, China) and Premix pro Taq HS qPCR Kit II (Accurate Biology, China) were employed for large‐scale screening of mature miRNAs, while detection of miR‐100‐3p relied on the miRNA 1st strand cDNA synthesis kit (by stem‐loop) (Vazyme, China) and miRNA universal SYBR qPCR master mix (Vazyme, China). For mRNA and pri‐miRNA analyses, HiScript III All‐in‐One RT superMix perfect for qPCR and ChamQ SYBR qPCR master mix (without ROX) (both from Vazyme, China) were used, respectively. Tsingke Biotech (China) synthesized all primers, and their specific sequences are provided in the Appendix S1. Expression levels were calculated using the 2−ΔΔCt method, and GAPDH or U6 served as reference genes for normalization. The sequence of primers used in this study can be found in Appendix S1.

Chen L., Hu Y., Zhang M., Liu L., Ma J., Xu Z., Zhang J., Gu H, & Chen K. (2024). METTL14 affects UVB‐induced human dermal fibroblasts photoaging via miR‐100‐3p biogenesis in an m6A‐dependent manner. Aging Cell, 23(5), e14123.

+ Open protocol

+ Expand

qRT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation and cDNA synthesis were performed following the manufacturer’s instructions. cDNA samples were diluted 20-fold with molecular biology grade water. The qRT-PCR assay (Vazyme Biotech Co. Ltd., Nanjing, China) was conducted using ChamQ SYBR qPCR Master Mix (without ROX) (Vazyme Biotech Co. Ltd., Nanjing, China) in CFX96 touch real-time PCR detection system (Biorad). The list of primers used is shown in Additional file 2: Table S10.

Xu M., Chen G., Dong Y., Xiang S., Xue M., Liu Y., Song H., Song H, & Wang Y. (2022). Stable expression of a truncated TLX variant drives differentiation of induced pluripotent stem cells into self-renewing neural stem cells for production of extracellular vesicles. Stem Cell Research & Therapy, 13, 436.

+ Open protocol

+ Expand

Quantitative Analysis of PD-L1 Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The real-time PCR analysis was conducted as previously described⁴⁰ (link). In brief, the total cellular RNA was isolated by Trizol Reagent (Thermo Fisher Scientific) according to the manufacturer's protocols. The qPCR primers were as follows: PD-L1, forward: TATGGTGGTGCCGACTACAA, reverse: TGCTTGTCCAGATGACTTCG; β-actin, forward: TCCTGTGGCATCCACGAAACT, reverse: GAAGCATTTGCGGTGGACGA. The qPCR reactions were conducted using ChamQ SYBR qPCR Master Mix (without ROX) (Vazyme) following the manufacturer's protocols. Data were analyzed using the 2^–ΔΔCt method after normalization with the β-actin expression level in each sample.

Luo M., Xia Y., Wang F., Zhang H., Su D., Su C., Yang C., Wu S., An S., Lin S, & Fu L. (2021). PD0325901, an ERK inhibitor, enhances the efficacy of PD-1 inhibitor in non-small cell lung carcinoma. Acta Pharmaceutica Sinica. B, 11(10), 3120-3133.

+ Open protocol

+ Expand

RT-qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For real-time quantitative PCR (RT‒qPCR) analysis, samples were collected at different time post-transfection. The related reaction was conducted with the CFX 96 Real-Time Detection System (Bio-Rad, CA, United States) using ChamQ SYBR qPCR Master Mix (without ROX) (Vazyme, Nanjing, China). Program conditions for thermal cycling were 95°C for 30 s, 40 cycles of 95°C for 5 s, and 60°C for 30 s. Three biological replicates were used for each treatment. Ct values were normalized to T. ni ribosomal protein S5, S. frugiperda actin, D. melanogaster ribosomal protein L32 and Homo sapiens GAPDH genes, respectively. The relative expression was calculated using the 2^-△△Ct method (Livak and Schmittgen, 2001 (link)). Primers were designed on Primer3web, and their sequences are listed in Supplementary Table S1.

Song J., Yu Y., Yan Z., Xiao S., Zhao X., Wang F., Fang Q, & Ye G. (2023). Chloride intracellular channel gene knockdown induces insect cell lines death and level increases of intracellular calcium ions. Frontiers in Physiology, 14, 1217954.

+ Open protocol

+ Expand

Quantifying Gene Expression in Maize Seedlings

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from the seedling leaf of B73 and Baimaya was extracted with RNA extraction reagent (Surbiopure, Guangzhou, China) and reverse transcribed into cDNA with All-in-one First-Strand Synthesis MasterMix with dsDNase (Xinkailai, Guangzhou, China). The cDNA was diluted 5 times and used as the template for quantitative real-time PCR (qPCR). DUF was used as a housekeeping gene [31 (link)]. qPCR was performed using CFX Connect™ Real-Time PCR Detection System (Bio-Rad, USA) and ChamQ SYBR qPCR Master Mix without ROX (Vazyme, Guangzhou, China). Quantification of qPCR results using the 2^−△△CT method [32 (link)]. Primer sequences for related genes are listed in Table S2. Three biological replicates were carried out.

Gong G., Jia H., Tang Y., Pei H., Zhai L, & Huang J. (2024). Genetic analysis and QTL mapping for pericarp thickness in maize (Zea mays L.). BMC Plant Biology, 24, 338.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!