DNA fragment coding Dsup protein with codon optimization for D. melanogaster was synthesized in Evrogen (Russia) and introduced in pAL2 plasmid Evrogen (Russia). D. melanogaster Act5C gene promoter was PCR amplified with the primers gtgaattctagagtacactcttcatggcg and tgtggaggatccgtctctggattagacg from D. melanogaster Oregon-R strain genomic DNA, digested with XbaI and BamHI (Thermo Fisher Scientific) and cloned into the pCaSpeR4 plasmid (Drosophila Genomics Resource Center, Bloomington USA, stock #1213) digested with XbaI and BamHI (Thermo Fisher Scientific). The BglII – EcoRI fragment containing Dsup gene from pAL2-Dsup plasmid was cloned into the pCaSpeR4-Act5Cpromoter plasmid digested with BamHI and EcoRI (Thermo Fisher Scientific). Resulted pCaSpeR4-Act5Cpromoter-Dsup plasmid was used for P-element mediated germline transformation.43 (link)
Bamhi
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Lithuania, China, Canada, France, Japan
BamHI is a type II restriction endonuclease enzyme that recognizes and cleaves the palindromic DNA sequence 5'-GGATCC-3'. It is widely used in molecular biology and genetic engineering for the manipulation and analysis of DNA.
Automatically generated - may contain errors
Lab products found in correlation
Ecori, by Thermo Fisher Scientific (57 mentions)
T4 dna ligase, by Thermo Fisher Scientific (37 mentions)
Xhoi, by Thermo Fisher Scientific (34 mentions)
Hindiii, by Thermo Fisher Scientific (31 mentions)
Xbai, by Thermo Fisher Scientific (15 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (9 mentions)
T4 ligase, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Ecorv, by Thermo Fisher Scientific (5 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions)
Bglii, by Thermo Fisher Scientific (4 mentions)
Ampicillin, by Merck Group (4 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (4 mentions)
Hind 3, by Thermo Fisher Scientific (4 mentions)
Rnase h buffer, by New England Biolabs (4 mentions)
Rnase h, by New England Biolabs (4 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Proteinase k, by Thermo Fisher Scientific (3 mentions)
Rnase a, by Thermo Fisher Scientific (3 mentions)
226 protocols using bamhi
1
Dsup Protein Expression in Drosophila
2
Cloning B7-H1 Promoter with mCherry Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from the B7-H1 expressing melanoma cell line UKRV-Mel-14a using the QIAamp DNA Mini Kit (Qiagen) according the manufacturers’ protocol. The B7-H1 promoter was amplified by PCR with Taq DNA polymerase Kit (Invitrogen) employing the forward primer 5′-AAAGGTACCTAGAAGTTCAGCGCGGGATA-3′ and the reverse primer 5′-AAAGGATCCCAGCGAGCTAGCCAGAGATA-3′. The specific PCR product was purified and cloned into the pMiR REPORT vector (Ambion, Austin, Texas, USA) using the restriction enzymes KpnI and BamHI (Fermentas) replacing the CMV promoter as recently described [23 (link)]. For replacing the luciferase (luc) reporter gene by the red fluorescent m-cherry protein, the m-cherry sequence was amplified from the pmR-m-cherry vector (Clontech, Mountain View, CA, USA) applying the forward primer 5′-AAAGGATCCATGGTGAGCAAGGGCGAGGA-3′ and the reverse primer 5′-AATGTGGTATGGCTGATTAT-3′. The PCR product was digested with BamHI (Fermentas) and SpeI (NEB, Ipswich, MA, USA) and cloned behind the B7-H1 promoter sequence in the pMiR REPORT backbone replacing the luciferase gene. The plasmid map is shown in Additional file 1 : Figure S1.
3
Generation and Cloning of AID Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For generation of the AID-SRC, genomic AID (Accession Number NG_011.588.1) spanning exons 2–5 was PCR amplified with a proof reading polymerase (PrimeStar, Takara) using primer RG486 and RG487. The PCR product was gel purified (Qiagen) and cloned into pEGFP-C3 (Clontech) using restriction enzymes HinDIII and BamHI (Fermentas). For generation of cDNA fusion constructs, the coding region of AID-FL was PCR amplified using primers RG210 and RG467 and cloned into pEGFP-N1 using restriction enzymes NheI and BamHI (Fermentas). For cloning into a murine ecotropic retrovirus vector, AID-SRC was PCR amplified using primers RG509 and RG499 and cloned into pMX-Ig 43 (link) using the restriction site Bam HI to obtain pMxAID-SRC. For construction of pMxGFP-AID, a GFP-AID fusion coding region was generated by PCR amplification of GFP from pMx plasmids using primer pairs RG131 and RG133 and of AID using primers RG134 and RG135 followed by a separate PCR using both PCR products as templates and the outer primers RG131 and RG135. The GFP-AID PCR product was cloned into pMx plasmid using BamHI/SalI (primers listed in Supporting Information Table 2)
4
Designing shRNAs for Gene Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four short hairpin RNAs (shRNAs) targeting EGR1 were designed. The forward and reverse sequences were ligated to the circular loop sequence (5'-CGAA-3'), and the reverse sequence was ligated to the termination sequence (5'-TTTTTT-3') and the BamH I (Fermentas, China) restriction site at the 5' end. At the 3' end, there was an EcoRI (Fermentas, China) restriction site. The recombinant vectors were named shEGR1-1, shEGR1-2, shEGR1-3, and shEGR1-4. The pRNAT-H1.1/Shuttle-RFP (Scotch Plams, USA) empty plasmid was used as a control. To verify the speci city of the interfering fragment, the rescue vector pcDNA3.1-EGR1 Δ was constructed.
Three short hairpin RNAs (shRNAs) targeting lncRNA HOTAIR were designed. The forward and reverse sequences were ligated to the circular loop sequence (5'-CGAA-3'), and the reverse sequence was ligated to the termination sequence (5'-TTTTTT-3'), and the BamHI (Fermentas, China) restriction site at the 5' end. At the 3' end, there was a HindIII (Fermentas, China) restriction site. The recombinant vectors were named shLncRNA HOTAIR-1, shLncRNA HOTAIR-2, and shLncRNA HOTAIR-3. The pRNAT-H1.1/Shuttle-RFP (Scotch Plams, USA) empty plasmid was used as a control. To verify the speci city of the interfering fragment, the rescue vector pcDNA3.1-LncRNA HOTAIR Δ was constructed. The sequences of the shRNAs are shown in Table 2.
Three short hairpin RNAs (shRNAs) targeting lncRNA HOTAIR were designed. The forward and reverse sequences were ligated to the circular loop sequence (5'-CGAA-3'), and the reverse sequence was ligated to the termination sequence (5'-TTTTTT-3'), and the BamHI (Fermentas, China) restriction site at the 5' end. At the 3' end, there was a HindIII (Fermentas, China) restriction site. The recombinant vectors were named shLncRNA HOTAIR-1, shLncRNA HOTAIR-2, and shLncRNA HOTAIR-3. The pRNAT-H1.1/Shuttle-RFP (Scotch Plams, USA) empty plasmid was used as a control. To verify the speci city of the interfering fragment, the rescue vector pcDNA3.1-LncRNA HOTAIR Δ was constructed. The sequences of the shRNAs are shown in Table 2.
5
Cloning of Protein into pFastBac HT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR product was gel purified and double digested with BamHI and EcoRI (Thermo scientific, USA) and then ligated into BamHI and EcoRI pre-digested pFastBac HT (Invitrogen, USA). The ligation product was incubated overnight at room temperature and then used for transformation of E. coli strain Top10. The transformants were plated on LB agar plates containing 100µg/mL ampicillin and incubated at 37 ºC for 24 h.
6
Introducing TRPC6M131T Mutant in Lentiviral Vector
7
Constructing Plasmids for pid Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inserts that were ligated in the vectors were obtained via PCR with Phusion DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA). Primers were synthesized by IDT (Leuven, Belgium) and can be found in Table 2 . Constructs were validated via Sanger sequencing (Macrogen Europe B.V., Amsterdam, the Netherlands).
Plasmids pFPV-P22-Ppidwt-gfp, pFPV-P22-PpidC–182A-gfp, and pFPV-P22-PpidC–183A-gfp were constructed by digesting pFPV25 with XbaI and BamHI (Thermo Fisher Scientific, Waltham, MA, USA). The digested vector was subsequently ligated with the (mutated) 5′ regulatory region of pid. The latter amplicon was obtained using primers P22_pid_Fw and P22_pid_Rev and digested with XbaI and BamHI, prior to ligation.
Plasmids pFPV-P22-Ppid338-gfp and pFPV-P22-Ppid232-gfp were constructed by digesting pFPV25 with XbaI and BamHI (Thermo Fisher Scientific, Waltham, MA, USA). The digested vector was subsequently ligated with a truncated 5′ regulatory region of pid of either 338 bp or 232 bp. The latter amplicons were obtained, respectively, using primer pairs P22_pid338_Fw and P22_pid_Rev or P22_pid232_Fw and P22_pid_Rev, and digested with XbaI and BamHI prior to ligation.
Plasmids pFPV-P22-Ppidwt-gfp, pFPV-P22-PpidC–182A-gfp, and pFPV-P22-PpidC–183A-gfp were constructed by digesting pFPV25 with XbaI and BamHI (Thermo Fisher Scientific, Waltham, MA, USA). The digested vector was subsequently ligated with the (mutated) 5′ regulatory region of pid. The latter amplicon was obtained using primers P22_pid_Fw and P22_pid_Rev and digested with XbaI and BamHI, prior to ligation.
Plasmids pFPV-P22-Ppid338-gfp and pFPV-P22-Ppid232-gfp were constructed by digesting pFPV25 with XbaI and BamHI (Thermo Fisher Scientific, Waltham, MA, USA). The digested vector was subsequently ligated with a truncated 5′ regulatory region of pid of either 338 bp or 232 bp. The latter amplicons were obtained, respectively, using primer pairs P22_pid338_Fw and P22_pid_Rev or P22_pid232_Fw and P22_pid_Rev, and digested with XbaI and BamHI prior to ligation.
8
Southern Blot Analysis of Transgenic Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Southern blot [28] (link) was used to study the integration pattern and copy number of introduced genes, 20 μg of genomic DNA of transgenic and non-transgenic control plants were digested with 20 U BamHI (Thermo Scientific, Germany, BamHI cuts once within T-DNA, Fig. 1 ) at 37 °C overnight, followed by the addition of another 10 U of the enzyme and incubated for 4–5 h to complete digestion. The digested DNA was fractionated on a 1% agarose gel and blotted on a positively charged nylon membrane (Roche, Germany) as described by Sambrook et al. [29] . The membrane was hybridized with DIG-labeled 400 bp MdMyb10 probe (Table 1 ) using a PCR-DIG Mix kit (Roche, Germany).
9
Cloning HAA1 Gene into pRS416 Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HAA1 gene (containing the HAA1 coding sequence together with 1086 bp upstream and 412 bp downstream of the start and stop codon, respectively) was PCR-amplified from genomic DNA of strain CEN.PK113-13D with primers HAA1_BamHI_fw and HAA1_BamHI_rv (Table 2 ). Each of the two primers contained at its 3′ terminal end a sequence that is complementary to a region flanking the HAA1 gene, and at its 5′ terminal end the recognition site for the restriction enzyme BamHI. The amplified fragment was purified from the reaction mixture by using a PCR purification kit, and subsequently digested with BamHI (Thermo Fisher Scientific, MA, USA). The HAA1 gene was then ligated into the BamHI site of the dephosphorylated low copy (CEN/ARS) plasmid pRS416 [32 (link)] using T4 DNA ligase (Thermo Fisher Scientific, MA, USA). The ligation mixture was used to transform chemically competent E. coli cells, after which transformants were selected on LB medium containing 100 mg L−1 ampicilin. Plasmids were subsequently extracted from E. coli cells by using a commercial miniprep kit (Qiagen, Hilden, Germany). The correct integration of the HAA1 gene into the plasmid pRS416 was checked by restriction analysis, and the HAA1 gene sequence was verified by sequencing.
10
Engineered Fluorescent Reporters for Cellular Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reporter constructs generated and used in this study are illustrated in Figure 1A and have been deposited at Addgene (IDs: 138657 and 138658), including plasmid maps and sequencing data. Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!