Oe nc

Manufactured by RiboBio

Sourced in China

The Oe-NC is a laboratory equipment product offered by RiboBio. It is a device designed for nucleic acid extraction and purification. The core function of the Oe-NC is to isolate and concentrate nucleic acids, such as DNA and RNA, from various biological samples. The product specifications and detailed technical information are available upon request.

Automatically generated - may contain errors

Lab products found in correlation

26 protocols using oe nc

Regulation of M2 Macrophages and Colon Cancer by miR-155-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols

M2 macrophages were transfected with plasmids expressing inhibitor NC (NC of miR-155-5p inhibitor) or miR-155-5p inhibitor.
Meanwhile, SW48 cells were transfected with plasmids expressing mimic NC (NC of miR-155-5p mimic), miR-155-5p mimic, inhibitor NC, miR-155-5p inhibitor, sh-NC (scramble shRNA control), sh-ZC3H12B, oe-NC (empty virus vector), oe-ZC3H12B, oe-IL-6, oe-ZC3H12B + oe-IL-6, miR-155-5p mimic + oe-NC, or miR-155-5p mimic + oe-ZC3H12B.
The miR-155-5p mimic and miR-155-5p inhibitor and their controls were purchased from Guangzhou RiboBio (Guangdong, P.R. China). Upon reaching 85–90% cell confluence, M2 macrophages or SW48 colon cancer cells were transfected with plasmids (80 nM) according to the manuals for Lipofectamine 2000 reagents (Invitrogen, Carlsbad, CA, USA). pGCSIL-PUR lentivirus encoding human ZC3H12B (sh-ZC3H12B) and Lenti-OE lentivirus overexpressing IL-6 or ZC3H12B were purchased from Shanghai Genechem (Shanghai, P.R. China). After 6 h of transfection the medium was renewed, and the cells were collected for subsequent experiments after 48 h.
Cy3-labeled miR-155-5p was transfected into M2 macrophages with the Lipofectamine 2000 reagent (Invitrogen). Macrophages containing Cy3-miR-155-5p were cocultured with SW48 cells and observed and detected with a fluorescence microscope and flow cytometry.

Ma Y.S., Wu T.M., Ling C.C., Yu F., Zhang J., Cao P.S., Gu L.P., Wang H.M., Xu H., Li L., Wu Z.J., Wang G.R., Li W., Lin Q.L., Liu J.B, & Fu D. (2021). M2 macrophage-derived exosomal microRNA-155-5p promotes the immune escape of colon cancer by downregulating ZC3H12B. Molecular Therapy Oncolytics, 20, 484-498.

+ Open protocol

+ Expand

Overexpression of FBW7 in H9C2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The FBW7 overexpression plasmid (Oe-FBW7) and its negative control (Oe-NC) were obtained from Guangzhou RiboBio Co., Ltd. Oe-FBW7 consisted of a pcDNA3.1 vector containing the full-length FBW7 cDNA sequence, with empty pcDNA3.1 as the negative control (Oe-NC). These vectors were transfected into H9C2 cells using Lipofectamine^® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at a concentration of 50 ng/ml for 48 h at 37˚C. The overexpression transfection efficiency was determined using reverse transcription-quantitative (RT-q)PCR and western blotting 48 h post-transfection.

Liu Q., Han C., Wu X., Zhou J, & Zang W. (2022). F-box and WD repeat-containing protein 7 ameliorates angiotensin II-induced myocardial hypertrophic injury via the mTOR-mediated autophagy pathway. Experimental and Therapeutic Medicine, 24(1), 464.

+ Open protocol

+ Expand

Modulating MT1X Expression in Leukemia Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

siNC, siMT1X (siMT1X-1, siMT1X-2, and siMT1X-3), mimic NC, miR-376a-3p mimic, oe-NC and oe-MT1X were purchased from RiboBio (Guangzhou, China). The siMT1X-1 sequence was 5’-GGCTCCTGCAAATGCAAAGAGTGCA, siMT1X-2 sequence was 5’- GAGTGCAAATGCACCTCCTGCAAGA, siMT1X-3 sequence was 5’- CATCTGCAAAGGGACGTCAGACAAG, and the siNC sequence was 5’- AATGGAGTCACCTCGCACTGGACAA. THP1 and K562 cells were plated into 6-well plates at a concentration of 3 × 10⁶ /well for 24 h before transfection with 2 μg oe-MT1X or 40pmol siMT1X or 40pmol miR-376a mimic by electroporation (Bio-rad, USA) following the manufacturer’s instructions.

Xin X., Xu Z., Wei J, & Zhang Y. (2022). MiR-376a-3p increases cell apoptosis in acute myeloid leukemia by targeting MT1X. Cancer Biology & Therapy, 23(1), 234-242.

+ Open protocol

+ Expand

HNEPC Overexpression Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human nasal epithelial cells (HNEPC) were purchased from iCell Bioscience Inc. (Shanghai, China). The cells were grown in an incubator at 37°C and 5% CO₂ using airway epithelial cell growth medium (PromoCell, Heidelberg, Germany). The cells at logarithmic growth phase were transfected with oe-NC or oe-XBP1 (RiboBio Co., Ltd., Guangzhou, Guangdong, China). Transfection was performed using the Lipofectamine 2000 transfection kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the instructions. The transfected cells were added to airway epithelial cell growth medium and incubated in a 5% CO₂, 37°C incubator until stable state for subsequent experiments.

Qu X., Li H, & Meng L. (2022). XBP1 Regulates the Transcription of HIF-1a in BALB/c Mice with Chronic Rhinosinusitis without Polyps. Analytical Cellular Pathology (Amsterdam), 2022, 3066456.

+ Open protocol

+ Expand

Glioma Cell Lines and Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Glioma cell lines (T98G, LN229, CRT, U251, M059J, and M059K), normal human astrocytes (NHAs), and 293T cells were purchased from the Cell Bank of Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences (Shanghai, China). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, United States) with 10% FBS (Gibco, Waltham, MA, United States) in a 37°C, 5% CO₂ environment. All plasmids, Sh-NC, Sh-circTLK1#1, Sh-circTLK1#2, OE-NC, and OE-circTLK1#1, were purchased from RiboBio (Guangzhou, China). All transfections were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States) following the manufacturer’s instructions.

Li J., Zhao Z., Wang X., Ma Q., Ji H., Wang Y, & Yu R. (2021). PBX2-Mediated circTLK1 Activates JAK/STAT Signaling to Promote Gliomagenesis via miR-452-5p/SSR1 Axis. Frontiers in Genetics, 12, 698831.

+ Open protocol

+ Expand

Overexpression and Knockdown of GTSE1 in Osteosarcoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Short hairpin (sh) RNA and overexpression vector of GTSE1 (sh-GTSE1; oe-GTSE1), and the negative control (NC) vectors (sh-NC and oe-NC) were all procured from RiboBio Co., Ltd. (Guangzhou, Guangdong China). MG-63 cells were transfected with sh-GTSE1 or sh-NC, and 143B cells were transfected with oe-NC or oe-GTSE1 for in vitro experiments. MG-63 cells transfected with oe-GTSE1, sh-GTSE1, and empty vector (EV) were used for in vivo experiments. All transfections were conducted using the lipofectamine 2000 kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). Stably transfected cells were screened using 2 μg/mL puromycin (Sigma-Aldrich, St Louis, MO, USA). Successfully transfected cells were cultured in DMEM at 37 °C with 5% CO₂ for subsequent use.

Xie C., Xiang W., Shen H, & Shen J. (2021). GTSE1 is possibly involved in the DNA damage repair and cisplatin resistance in osteosarcoma. Journal of Orthopaedic Surgery and Research, 16, 713.

+ Open protocol

+ Expand

Transfection of miRNA and Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA-93-5p mimics (miR-mimics), negative control mimics (miR-NC), pcDNA3.1-KLF9 plasmids encoding KLF9 (oe-KLF9), and blank pcDNA3.1 plasmids (oe-NC) were bought from RiboBio (Guangzhou, China). The Lipofectamine 2000 kit (Invitrogen, USA) was applied to transfect miR-mimics, miR-NC, or target plasmids into cancer cell lines.

Li T., Xu Q., Wei Y., Lin R., Hong Z., Zeng R., Hu W, & Wu X. (2022). Overexpression of miRNA-93-5p Promotes Proliferation and Migration of Bladder Urothelial Carcinoma via Inhibition of KLF9. Computational and Mathematical Methods in Medicine, 2022, 8911343.

+ Open protocol

+ Expand

MET and MCL-1 Regulation in Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

MET overexpression vector (oe-MET), the lentivirus short hairpin RNA (shRNA) against MET or MCL-1 (shMET or shMCL-1), and their controls (oe-NC and shNC) were synthesized from Ribobio (Guangzhou, China). They were transfected into cells with lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). 24 h later, cells were treated with 1 μM anlotinib, 2 μM DDP, or 20 μM ACT001 (Accendatech Co., Ltd., Tianjin, China) for 24 h.

Wang L., Xu L., Han S, & Zhu X. (2024). Anlotinib Inhibits Cisplatin Resistance in Non-Small-Cell Lung Cancer Cells by Inhibiting MCL-1 Expression via MET/STAT3/Akt Pathway. Canadian Respiratory Journal, 2024, 2632014.

+ Open protocol

+ Expand

Transfection of Bladder Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

MicroRNA-143-3p mimic, mimic NC, si-TBX3, si-NC, oe-TBX3, and oe-NC were designed by Guangzhou RiboBio. Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) was applied to transiently transfect synthesized sequences or plasmids into bladder cancer cells T24 or BIU-87. Cells were incubated in corresponding mediums with 5% CO₂ at 37°C for use. Before transient transfection, all cells were cultured for at least 24 h and needed to be washed with phosphate-buffered saline (PBS) (pH 7.4).

Huang L., Zhang X., Li F, & Wang X. (2022). MicroRNA-143-3p/TBX3 Axis Represses Malignant Cell Behaviors in Bladder Cancer. Computational and Mathematical Methods in Medicine, 2022, 2880087.

+ Open protocol

+ Expand

Modulating Osteoblast Differentiation via APT1

Check if the same lab product or an alternative is used in the 5 most similar protocols

oe-APT1 plasmid (pcDNA3.1-APT1) and its negative control oe-NC (pcDNA3.1-NC), and small interfering RNA si-APT1 and its negative control si-NC were synthesized by RiboBio. Cells in the logarithmic growth phase were transfected with oe-APT1, si-APT1, and their negative controls using Lipofectamine 2000 transfection kit (Invitrogen, Carlsbad, CA, USA).
The osteoblasts were allocated into 8 groups: (1) control (SAMR1 mouse osteoblasts without any treatment); (2) SOP (SAMP6 mouse osteoblasts without any treatment); (3) SOP + oe-NC (SAMP6 mouse osteoblasts transfected with oe-NC for 48 h); (4) SOP + oe-APT1 (SAMP6 mouse osteoblasts transfected with oe-APT1 for 48 h); (5) SOP + si-NC (SAMP6 mouse osteoblasts transfected with si-NC for 48 h); (6) SOP + si-APT1 (SAMP6 mouse osteoblasts transfected with si-APT1 for 48 h); (7) SOP + oe-APT1 + LDN-193189 (SAMP6 mouse osteoblasts cultured in 0.5 μmol/L LDN-193189 medium for 2 d after transfection with oe-APT1 for 48 h); (8) SOP + oe-APT1 + PBS (SAMP6 mouse osteoblasts cultured in an equal concentration of PBS for 2 d after transfection with oe-APT1 for 48 h).

Ji C., Dong Q., Liu H., Yang X., Han Y., Zhu B, & Xing H. (2023). Acyl-protein thioesterase1 alleviates senile osteoporosis by promoting osteoblast differentiation via depalmitoylation of BMPR1a. Regenerative Therapy, 24, 351-360.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!