Rna extraction kit

The treated cells were prepared in accordance with the RNA extraction kit (Bioer, Hangzhou, China). Follow the instructions to obtain RNA after adding lysate R1, lysate R2, washing solution, and eluent in sequence. RNA concentration was measured, then reverse-transcribed (TaKaRa, Kusatsu, Japan), and subjected to qPCR (SYBR: TaKaRa, Kusatsu, Japan). The samples were detected on a Real-Time PCR Detection (Bio-Rad Laboratories) under the following conditions: 95°C for 5 minutes, 40 cycles of denaturation for 3 seconds at 95°C, 30 seconds of annealing at 58°C, elongation at 72°C for 30 seconds, and extension at 65°C for 5 seconds. CFX Manager software (Bio-Rad CFX Manager 3.1) was used to analyze the data. Primer sequences are shown in Table 1.

Pseudoviruses containing SARS-CoV-2 variant S protein and the backbone of deficient vesicular stomatitis virus (VSV) vector (VSV-ΔG-GFP) (BrainVTA) were generated using the previously described protocols^{47 (link),48} . In brief, 30 μg of S plasmid with a C terminal 18 amino acids truncation was transfected into HEK293T cells cultured in a 10 cm dish, then after 24 h the VSV-ΔG-GFP pseudoviruses were added into the cell supernatant. The inoculum was then removed following incubation at 37 °C for 2 h and the cells were washed with PBS and cultured in DMEM supplemented with both 10% FBS and anti-VSV-G antibody (produced by I1Hybridoma ATCC^® CRL2700™). Then 20 h post-infection, the supernatants were harvested, filtered (0.45 μm filter, Millipore, Cat#SLHP033RB), aliquoted, and stored at −80 °C.
Prior to quantification, the unpackaged RNA in the SARS-CoV-2 pseudoviruses was removed using a 0.5 U/μL BaseMuncher endonuclease (Abcam) treatment at 37 °C for 1.5 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified using a quantitative RT-PCR assay performed using a 7500 Fast Real-Time PCR system (Applied Biosystems). The primers and probe used to detect the L gene of the VSV virus are as described in the literature^{49 (link)}: VSV-F: TGATACAGTACAATTATTTTGGGAC; VSV-R: GAGACTTTCTGTTACGGGATCTGG; VSV-probe: FAM-ATGATGCATGATCCWGC-TAMRA.

To obtain SARS-CoV-2 PT and variants pseudoviruses, we constructed replication-deficient vesicular stomatitis virus vector backbone (VSV-ΔG-GFP) expressing the corresponding spike proteins. 30 mg of spike protein expression plasmids were transfected into HEK293T cells each 10 cm culture dish. After 24 h, The VSV-ΔG-GFP pseudoviruses were added to the transfected cell supernatant. After incubation for 2 h at 37 °C, inoculum was replaced with fresh DMEM containing both 10% FBS and anti-VSV-G antibody produced by I1HybridomaATCC®-CRL2700™. The pseudovirues were obtained 30 h post-infection. After being filtered by 0.45 mm filters (Millipore, Cat#SLHP033RB), the pseudoviruses were aliquoted and stored at −80 °C.
0.5 U/mL BaseMuncher endonuclease (Abcam) was used to remove unpackaged RNA at 37 °C for 1 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified by quantitative RT-PCR.