Chromium single cell 3 v2 kit

We performed single-cell RNA-seq of live CD45^- thymic cells by MACS negative separation (about 99% purity confirmed by FACS analysis) to enrich epithelial cells. Library preparation was carried out on fresh cells directly after MACS separation using the Chromium Single Cell 3’ V2 Kit (10X Genomics). Briefly, single cells with cell viability >85% (800–1200 cells/μl, about 15,000 cells for each sample aiming to capture 6,000–10,000 valid cells) were loaded on a 10X Genomics Chromium Single-cell ChIP along with the single-cell master mix and single-cell 3’ gel beads to generate single-cell gel bead-in-emulsions (GEMs). After droplet generation, samples were transferred into PCR tubes and reverse transcription was performed using a C1000 Touch Thermal Cycler (Bio-Rad). Then, cDNA recovery, amplification, and library construction were performed with the Chromium Single Cell 3’ V2 Kit (10X Genomics) following the manufacturer’s instructions. Libraries were sequenced on Illumina Hiseq PE150 platform at an average read depth of about 84,000 reads per cell.

Single‐cell RNA‐seq was performed using the 10× Genomics Chromium Single Cell Controller with the Chromium Single Cell 3′ V2 Kit (Chromium Single Cell 3ʹ Library and Gel Bead Kit v2, 16 rxns PN‐120237, Chromium Single Cell A Chip Kit, 48 rxns PN‐120236, Chromium i7 Multiplex Kit and 96 rxns PN‐120262, all from 10× Genomics, USA) following the manufacturer's instructions with barcoded gel beads at a target capture rate of 10 000 individual cells per sample. After quality control, libraries were sequenced on the Illumina HiSeq X‐ten platform in 2 × 150 bp paired‐end mode.

For low-input RNA-seq, Smart-seq2 libraries^{56 (link)} (poly-A selected) were prepared for the 90 flow-sorted samples (each 1000 cells). These samples were composed of seven main cell types (CD4⁺ T, CD8⁺ T, MAIT, iNKT, Vδ1, Vδ2, and NK cells) from six healthy donors, and three additional cell types (δ/αβ, Vδ3, and B cells) from one healthy donor. Each sample had two duplicates. Samples were randomized within the plate. Twenty-five-base paired-end sequencing was performed yielding 4–12 M read pairs (8–24e6 reads, Supplementary Figure 4).
For single-cell RNA-Seq, mRNA and hashing library preparation^{57 (link)} was performed by the Brigham and Women’s Hospital Single Cell Genomics Core using the Chromium Single Cell 3' v2 kit (10x Genomics). The following D7 index primer was used (sample barcode underlined): CAAGCAGAAGACGGCATACGAGATGACTGACAGTGACTGGAGTTCAGACGTGTGC.