Absolutely rna miniprep kit

Total RNA was extracted from ∼80% confluent 6 cm dishes using the Agilent Absolutely RNA Miniprep Kit with on-column DNase digestion. After ribosomal RNA depletion with the Illumina Ribozero kit, libraries were constructed using either ScriptSeq v2 or TruSeq v2 kits and sequenced on an Illumina HiSeq2500 platform (50 nt single-end reads). Total RNA from Skiv2l^fl/fl conditional knockouts was extracted after culturing the cells in media supplemented with 0.1 μM 4OHT for 0, 2, 4 or 6 days to induce Skiv2l knockout.
To measure transcriptome-wide RNA half-lives, 300,000 mESCs were seeded per well of a six-well dish and grown for 48 h in serum + LIF medium. The medium was replaced by fresh medium with 5 μM actinomycin D (from a 5 mg/ml stock in DMSO) and the cells were incubated for 120, 240 or 360 min. A mock treatment (360 min) was included, using medium with the same amount of DMSO but no actinomycin D. After the indicated times, cells were washed twice with 37°C PBS and RNA extracted using the Agilent Absolutely RNA Miniprep Kit. ERCC RNA spike-ins were added to the lysis buffer (1.7 μL of a 1:10 dilution per sample) before it was added to the cells. Three technical replicates were performed for each cell line, treatment and time point.

Absolutely RNA Miniprep Kits (Agilent, Santa Clara, CA) were used to isolate total RNA individually from lumbar spinal cord tissue from each mouse. Complementary DNA (cDNA) was reverse-transcribed from total RNA using high-capacity cDNA reverse transcription kits (Applied Biosystems, Mulgrave, Victoria, Australia). Quantitative BDNF and TrkB messenger RNA (mRNA) expression levels were analyzed using SYBR® Green PCR master mix (Applied Biosystems) and specific primers. The specificity of the real-time PCR reaction was confirmed using melting curve analysis. Primers used were (1) 18S-forward: CCCTCCAATGGATCCTCGTT; 18S-reverse: TCGAGGCCCTGTAATTGGAA (2) BDNF QuantiTect® primer assay, Mm_Bdnf_1_SG (Qiagen, Pty Ltd., Victoria, Australia) and (3) TrkB QuantiTect® primer assay, Mm_Ntrk2_vb.1_SG (Qiagen) containing a mixture of forward and reverse primers.

After media treatments were added, 0 h plates were imaged. Media and RNA samples were collected immediately after imaging the cells. The media was aspirated off the cells, placed in microcentrifuge tubes, and placed directly in a −80 °C freezer. Tissue culture plates were then placed directly on ice, and cells were washed twice with cold PBS containing 1x ABAM to remove any remnants of media. After cells were washed, lysis buffer from Absolutely RNA Miniprep Kits (Agilent Technologies, Cedar Creek, TX, USA) was prepared according to the manufacturer’s instructions and placed on cells to initiate cell lysis. Once lysis buffer was administered, cells were further collected using a sterile cell scraper. After mechanically lyzing the cells, the supernatant was aspirated, placed in microcentrifuge tubes, and immediately placed in a −80 °C freezer until the remainder of the isolation process was completed. This was performed for both treatments with all cells. The other plates were placed in the incubator prior to sample collection at 12, 24, and 48 h, and subsequently, the same collection process as previously described was utilized. At each timepoint, each well of cells was imaged three times to capture a representation of cell confluency, and sample collection was performed in a sterile laminar hood.