Abi 3730xl genetic analyzer

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany

The ABI 3730XL Genetic Analyzer is a high-throughput DNA sequencing instrument designed for research applications. It utilizes capillary electrophoresis technology to efficiently analyze DNA samples and generate sequencing data.

Automatically generated - may contain errors

Lab products found in correlation

208 protocols using abi 3730xl genetic analyzer

Capillary Electrophoresis for Genetic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ABI-3730XL Genetic Analyzer™ (ThermoFisher Scientific) was used to process the data with Dye Set J6 from the six dyes (FAM (blue), HEX (green), TAMRA (yellow), Rox (red), VIC (purple) and OSD (orange)) after an appropriate matrix had been created and optimised. One microliter of PCR products or allelic ladders were diluted in a mixture of 8.5 µL of Hi-Di™ Formamide (ThermoFisher Scientific) and 0.5 µL of OSD700 internal size standard. Samples were injected at 3 kV for 10 s, and separated on an ABI-3730XL Genetic Analyzer™ using POP^TM-7 polymer (ThermoFisher Scientific) and 50-cm capillary (ThermoFisher Scientific). The bins and panels for the multiplex system were programmed for genotyping. Initial fragment sizing and allele calling were performed using GeneMappler^® IDX (ThermoFisher Scientific) with the peak amplitude threshold set at 50 relative fluorescence units (RFU) for all colours.

Liu F., Jia F., Sun F., Zhao B, & Shen H. (2019). Validation of a multiplex amplification system of 19 autosomal STRs and 27 Y-STRs. Forensic Sciences Research, 5(4), 292-299.

+ Open protocol

+ Expand

Genotyping of ABCA7 Loss-of-Function Variants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of ABCA7 pLOF mutations examined in our prior study was performed as previously described^{11 (link)} using Custom TaqMan SNP assays (Applied Biosystems, Foster City, CA) for 5 of the variants. Genotypes were analyzed on ABI Prism 7900 Detection System using SDS version 2.2.2 software (Applied Biosystems). For p.E709fs, the presence of the 7bp deletion was identified by generation of fluorescently labeled PCR products and assessed using the ABI3730xl Genetic Analyzer (Applied Biosystems) and GeneMapper Software 5.0 (Applied Biosystems). All ABCA7 pLOF mutations identified were validated by sequence analysis as described previously^{11 (link)} with the exception of rs20053873 (c.5570+5G>C), in which confirmation used PCR primer sequences for exon 41 (forward sequence: ctggggcctcactgagcacc; reverse sequence: gggcctggtccgcgtgtggg). PCR products and sequencing reactions were purified and ran using the Agencourt AMPure system (Beckman Coulter, Brea, CA) and BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and Agencourt CleanSEQ (Beckman Coulter) and ABI3730xl Genetic Analyzer (Applied Biosystems), respectively. Sequence analysis was performed using Sequencher 4.8 software (Gene Codes Corporation, Ann Arbor, MI).

Campbell A.S., Ho C.C., Atık M., Allen M., Lincoln S., Malphrus K., Nguyen T., Oatman S.R., Corda M., Conway O., Strickland S., Petersen R.C., Dickson D.W., Graff-Radford N.R, & Ertekin-Taner N. (2022). Clinical Deep Phenotyping of ABCA7 Mutation Carriers. Neurology: Genetics, 8(2), e655.

+ Open protocol

+ Expand

Genomic DNA Extraction and STR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from patient B-lymphocytes and UABi001-A and UABi002-A iPSCs were prepared by Quick-gDNA miniprep kit (Zymo) and submitted to the Genomics Core Laboratories at the UAB Heflin Center for Genomic Sciences. The STR analysis was performed using the GenePrint 24 Kit (Promega) and an ABI 3730xl Genetic Analyzer (Thermo Fisher).

Lee J., Liu Z., Tusing Y.G., Li C., Westin E., Li W, & Zhao R. (2021). Generation of inducible pluripotent stem cell lines from Alzheimer’s disease patients with APOE e3/e3 genotype. Stem cell research, 55, 102498.

+ Open protocol

+ Expand

PCR Amplification of Cancer Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification of various regions from the designated cancer-related genes was performed using KAPA Hyper polymerase (Roche Holding AG, Basil, CH) with the primer pairs found in Additional file 2: Table S2. Forward primers were tagged with M13 forward sequences and reverse primers tagged with M13 reverse sequences. The reaction was as follows: after preheating at 95 °C for 5 min, amplification consisted of 30 cycles at 98 °C for 20 s, 65 °C for 15 s and 72 °C for 15 s, and a final extension at 72 °C for 5 min. PCR products were purified using the AMpure® XP (Beckmann Coulter, Brea, CA) and quantified using the NanoDrop®. DNA (10 ng) was sequenced using the BigDye Terminator® cycle sequencing kit (v3.1; Thermo Fisher Scientific). Following purification using the Centri-Sep® Spin Columns (Thermo Fisher Scientific), the nucleotide sequences were determined using an ABI3730XL Genetic Analyzer (Thermo Fisher Scientific). Sequence data was aligned using Sequencher® DNA sequence analysis software (v5.2.4; Gene Codes Corporation, Ann Arbor, MI).

Foley J.F., Phadke D.P., Hardy O., Hardy S., Miller V., Madan A., Howard K., Kruse K., Lord C., Ramaiahgari S., Solomon G.G., Shah R.R., Pandiri A.R., Herbert R.A., Sills R.C, & Merrick B.A. (2018). Whole exome sequencing in the rat. BMC Genomics, 19, 487.

+ Open protocol

+ Expand

Genetic Screening for Parkinsonism and Dementia

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To exclude (possibly) pathogenic variants in other known genes causing parkinsonism or dementia (Supplementary Table 2) we performed whole exome sequencing (WES) and multiple ligation-dependent probe amplification (MLPA, P051-Parkinson mix 1) in the possibly pathogenic LRP10 variant carriers. WES was performed with the same protocol as previously reported in Jamra et al. (2017) [29 (link)]. An average depth of >84× was reached, with 99% of the target region covered >20×.
For copy number analysis, The P051-D1 Parkinson kit (MRC Holland) was used according to the manufacturer’s protocol. An ABI 3730XL Genetic Analyzer (Thermo Fisher Scientific) and Seqscape v3.0 (Thermo Fisher Scientific) were used for analysis. APOE genotyping was performed using TaqMan® SNP Genotyping Assay (Thermo Fisher Scientific).

Vergouw L.J., Geut H., Breedveld G., Kuipers D.J., Quadri M., Rozemuller A.J., van Swieten J.C., de Jong F.J., van de Berg W.D, & Bonifati V. (2020). Clinical and Pathological Phenotypes of LRP10 Variant Carriers with Dementia. Journal of Alzheimer's Disease, 76(3), 1161-1170.

+ Open protocol

+ Expand

STR Profiling of iPSCs and PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA of iPSCs (p52) and patient’s PBMCs was extracted using Quick-DNA Miniprep Plus Kit (Zymo Research). STRs were amplified using the PowerPlex16 (Promega) system and resolved on a ABI 3730xl Genetic Analyzer (Thermo Fischer Scientific). GeneMapper 5.0 (Thermo Fischer) software was used to call the genotype at each locus and compare between peripheral blood and iPSC samples.

Contreras J., Alonzo M., Ye S., Lin H., Hernandez-Rosario L., McBride K.L., Texter K., Garg V, & Zhao M.T. (2022). Generation of an induced pluripotent stem cell line NCHi003-A from a 11-year-old male with pulmonary atresia with intact ventricular septum (PA-IVS). Stem cell research, 64, 102893.

+ Open protocol

+ Expand

iPSC and PBMC Genomic DNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from iPSCs (passages 14–15) and PBMCs using the Quick-DNA Miniprep Plus Kit (Zymo Research). The PowerPlex 16 System (Promega) was then utilized to amplify genomic materials according to the manufacturer’s instructions. Samples were sent for capillary sequencing using an ABI 3730xl Genetic Analyzer (Thermo Fisher Scientific). GeneMapper 5.0 (Thermo Fisher Scientific) software was used to analyze the sequencing data for allele callings for 16 loci per sample. Only strong allele calling signals were considered for analysis.

Alonzo M., Contreras J., Ye S., Lin H., Hernandez-Rosario L., McBride K.L., Texter K., Garg V, & Zhao M.T. (2022). Characterization of an iPSC line NCHi006-A from a patient with hypoplastic left heart syndrome (HLHS). Stem cell research, 64, 102892.

+ Open protocol

+ Expand

STR Profiling of iPSCs and PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

STR Profiling of PriGIST and ImGIST Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PriGIST cells were used as control samples and ImGIST cells were identified using the short tandem repeat (STR) analysis. The DNA was extracted using a commercial kit from CORNING (AP-EMN-BL-GDNA-250G). Twenty-one STRs, including the amelogenin locus, were amplified using the PowerPlex 21D System (iCell) and separated using an ABI 3730XL Genetic Analyzer (Thermo Fisher Scientific Inc., Waltham, MA, USA). Signals were analyzed using GeneMapper ID V. 32.

Hu X., Su P., Liu B., Guo J., Wang Z., He C., Wang Z, & Kou Y. (2023). Characterization of a Human Gastrointestinal Stromal Tumor Cell Line Established by SV40LT-Mediated Immortalization. International Journal of Molecular Sciences, 24(17), 13640.

+ Open protocol

+ Expand

CDKL5 Variant Identification via WGS

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers were designed, using Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/), to cover the CDKL5 variant identified by WGS (primer sequences available on request). PCR was performed using the AmpliTaq Gold 360 master mix (ThermoFisher Scientific). After Exo/SAP purification (ThermoFisher Scientific), the amplicons were sequenced using BigDye V.3.1 Terminator chemistry (ThermoFisher Scientific). The sequencing products were cleaned up with Optima DTR columns (Edge BioSytems) and separated on an ABI 3730xl genetic analyzer (ThermoFisher Scientific). Data were evaluated using Sequencher V.5.0 software (Gene Codes).

Bodian D.L., Schreiber J.M., Vilboux T., Khromykh A, & Hauser N.S. (2018). Mutation in an alternative transcript of CDKL5 in a boy with early-onset seizures. Cold Spring Harbor Molecular Case Studies, 4(3), a002360.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!