Lightcycler real time pcr system

Total RNA was extracted using the miReasy kit (QIAGEN). Real-time quantification to measure miRNA was performed with the TaqMan miRNA reverse transcription kit and miRNA assay (Thermo Fisher Scientific). miRNA expression was normalized to the U6 small nucleolar RNA (snRU6). For mRNA analysis, cDNA was produced using the QuantiTect Reverse transcription kit (QIAGEN). Expression was normalized to 18S ribosomal RNA. Real-time qPCR was used to measure the expression of miR-96 (assay ID: 000186; Thermo Fisher Scientific), miR-182 (assay ID: 000597, Thermo Fisher Scientific), miR-183 (assay ID: 002269; Thermo Fisher Scientific), and snRU6 (assay ID: 001973; Thermo Fisher Scientific). ANLN and 18S rRNA preoptimized primers were obtained from MilliporeSigma (KiCqStart Primers). miR expression profiling of 150 miRs was performed using mouse miScript miRNA PCR arrays (96-well format; QIAGEN) and SYBR Green–based real-time PCR analysis, using the Roche LightCycler real-time PCR system. Relative expression was calculated using the 2-ΔΔ^Ct method (38 (link)). The web-based miScript miRNA PCR array data analysis tool was used to analyze the real-time PCR data (QIAGEN).

qRT-PCR was performed with a LightCycler real-time PCR system (Roche Applied Science, Penzberg, Germany) in a final volume of 10 μL [5 μL 2x SYBR green I Master (Roche, Basel, Switzerland), 300 nM of primer pairs, and 20–30 ng cDNA]. The gene encoding ribosomal protein L13a (rpl13a; ENSDARG00000044093) was used as an internal control. For each gene, a standard curve was used to confirm signals were in the linear range. The specificity of the primer sets was validated by the presence of a single peak in the dissociation curve. Primer sets used for RT-qPCR are shown in Table 1.

The expression levels of flavonoid biosynthetic pathway genes from Pakchoi were assessed by quantitative real-time PCR (qRT-PCR) using a Light Cycler^® real-time PCR system (96 version 1.1.0-.1320, Roche Diagnostics international Ltd.) with SYBR^® Premix Ex Taq^™(TaKaRa, Japan). Two sets of gene-specific primers were designed for each gene (Table 2) by using GenScript Real-time PCR (TaqMan) online Primer Design tool (https://www.genscript.com/ssl-bin/app/primer). Referred to the relevant studies [22 ], five genes were selected and tested to be used as the internal control (Table 3). The qRT-PCR was performed in three independent experimental repeats using a 20 μl total volume, where each experimental repeat contains at least three samples. The assembly of reaction mixture and amplification were carried out as previously described by Hassani et al. [27 (link)]. The best gene-specific primers and internal control for qRT-PCR were selected based on their electrophoresis profiling (Figs 1 and 2). Calculation of relative expression level was performed by 2^–ΔΔCT method [28 (link)].

Total RNA from GC cells and tissue specimens was extracted with Simply P Total RNA extraction Kit (BioFlux), and 2 μg of total RNA from each sample was reversely transcribed into cDNA using PrimeScript^™ RT Master Mix (Perfect Real Time; Takara). qRT‐PCR was performed using SYBR^® Premix Ex Taq^™ (Tli RNaseH Plus; Takara) in a Light Cycler Real‐time PCR System (Roche). The amplification was performed as follows: an initial denaturation step for 30 seconds at 95°C followed by 40 cycles of denaturation for 5 seconds at 95°C, annealing and extension for 30 seconds at 60°C. The specific primers used were as follows: GAPDH‐F: GGGAAGGTGAAGGTCGGAGT; GAPDH‐R: GGGGTCATTGATGGCAACA; HOXA10‐F: TCACGGCAAAGAGTGGTC; HOXA10‐R: AGTTTCATCCTGCGGTTCTG; BCL2‐F: ACTGGCTCTGTCTGAGTAAG; BCL2‐R: CCTGATGCTCTGGGTAAC. GAPDH was used as an internal control, and the relative quantities (Δ cycle threshold values) of each transcript were normalized to GAPDH. Each reaction was repeated in triplicate. The fold changes (2^−ΔΔCt) in HOXA10 and BCL2 mRNA expression were calculated using the following formulae: HOXA10ΔCt = (Avg. HOXA10_Ct − Avg. GADPH_Ct), HOXA10ΔΔCt = (HOXA10ΔCt_tumor − HOXA10ΔCt_non‐tumor); BCL2ΔCt = (Avg. BCL2_Ct − Avg. GADPH_Ct), BCL2ΔΔCt = (BCL2ΔCt_tumor − BCL2ΔCt_non‐tumor).

Total RNA was extracted 48 h after exposure to TGF-β and quantified by Nanodrop (Thermo Scientific; Wilmington, DE, USA). Complementary DNA (cDNA) was synthesized with a First Strand cDNA Synthesis Kit (Thermo Scientific) and then mixed with SYBR Green Master Mix (Roche; Mannheim, Germany) and gene-specific primers. qRT-PCR was performed using a LightCycler Real-Time PCR system (Roche). The sequences of primers used for the qRT-PCR are in Supplementary Table S3.