Sterile water

Pure cultures of all Candida reference strains and clinical isolates were homogenized in 100 μl of sterile water (B. Braun Medical, Inc., Germany) and incubated with lysis buffer (EDTA, Tris, Triton X-100), lysozyme (Sigma-Aldrich, USA) and lyticase (Sigma-Aldrich, USA) for 60 min at 37°C to disrupt the fungal cell wall. The DNA was isolated by using the fungal DNA isolation protocol with QIAamp DNA Blood Mini Kit (Qiagen, Germany). DNA purity and concentrations were measured using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., North Carolina, USA).

DNA extracts were tested in the seminested real-time PCR-HRMA (high resolution melt assay), with the first PCR reaction using a master mix composition and parameters as described for rnl real-time PCR-HRM. The amplicons recovered were diluted 1:300 with sterile water (B. Braun, Germany) and amplified using the same master mix composition in a real-time PCR run according to the following protocol: initial denaturation at 98.0 °C/1 min, followed by 20 cycles of 98.0 °C/5 s and 61.8 °C/30 s; denaturation at 98.0 °C/30 s and cooling at 70.0 °C/30 s; and generation of melt curve from 72.0 °C to 81.0 °C, with 0.1 °C increments/5 s dwell time. Subsequent analyses were performed as described for rnl real-time PCR-HRM. Species ID control DNAs for the four Mucorales species were extracted using the same procedure and added to each run. All experiments used biological duplicates and technical duplicates.

CHX digluconate solutions with concentrations of 0.2% and 0.12% in 7% ethanol (Saarland University Pharmacy, Homburg, Germany), Chlorhexamed® Forte 0.2% alcohol-free spray (GlaxoSmithKline Consumer Healthcare GmbH & Co. KG, Bühl, Germany), Curasept ADS® 712 gel toothpaste with 0.12% CHX digluconate (Curaden Swiss GmbH, Stutensee, Germany) and GUM® Paroex® dental gel with 0.12% CHX digluconate (Sunstar GmbH, Schönau, Germany) were used for the different CHX regimens. Sterile water (B. Braun, Melsungen AG, Germany), acetonitrile 100% and trifluoroacetic acid 99% (VWR International GmbH, Darmstadt, Germany), as well as α-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich, Steinheim, Germany), were used for matrix preparation. Disposable plastic spatulas (Ecospatula, Carl Roth GmbH & Co. KG, Karlsruhe, Germany) were used for scraping the buccal mucosa surface to collect the mucosal pellicle samples. MALDI 384 well stainless steel plates (Sciex, Darmstadt, Germany) were used as targets.

For rnl qPCR-high resolution melt (HRM) assay design, 82 rnl sequences representing R. arrhizus, R. microsporus, M. circinelloides, and Lichtheimia spp. complex (L. corymbifera and L. ramosa) were aligned with the R. arrhizus reference sequence (GenBank AY863212.1). Primers (2 rnl_127 fw: 5′–GGTGTAGAATACAAGGGAGTCGA–3′ and 2 rnl_250 rv: 5′–GGAGAAATCCGCCCCAGATAA–3′) generated an amplicon of 124 bp. These primers were tested in silico for cross-reactivity with human and not-targeted fungal DNA. The qPCR reaction contained 10 µL of SsoFast™ EvaGreen^® Supermix (Bio-Rad Laboratories Incorporated, Hercules, California, USA), 1 µL of 10 µM of each primer, 6 µL of ultrapure water, and 2 µL of DNA eluate. All samples were run in duplicate. As positive controls, a set of n = 4 previously identified representative Mucorales samples (R. arrhizus, R. microsporus, M. circinelloides, and Lichtheimia species complexes; AS119, F50, AS84, and FF18, respectively, Table S2) were used as templates, with sterile water (B. Braun, Melsungen, Germany) serving as no template control (NTC). The qPCR reactions were conducted using a CFX96™ real-time PCR detection system (Bio-Rad Laboratories Incorporated, Hercules, California, USA) under the following conditions: 98.0 °C/2 min, followed by 40 cycles of 98.0 °C/5 s and 61.8 °C/10 s.

Drug solutions (2 µL/g mouse body weight; 50 mg/kg/d abacavir and 0.1 mg/kg/d decitabine) were applied intraperitoneally on both sides using 30G insulin syringes (Omnican^®50, B. Braun) daily for 14 consecutive days (d1–14). Solutions were prepared freshly every two days using 0.9% NaCl (B. Braun) for abacavir sulfate (MilloporeSigma, Burlington, MA, USA; work solution 25 mg/mL) and sterile water (B.Braun) for decitabine (Abcam, Cambridge, UK; work solution 0.05 mg/mL) and stored at 4 °C. Placebo solutions without drugs were applied in the relevant mice.

DNA extraction was performed using commercially available kits following manufacturers’ instructions; for cyanobacterial cultures and plankton samples DNeasy PowerWater Sterivex kit (Qiagen, Germany) and for biofilm samples NucleoSpin Soil kits (Macherey-Nagel, Germany) were used. DNA was stored at –20 °C for further analyses. In each extraction, a blank control using sterile water (B. Braun, Germany) was included. DNA concentration and purity of the samples and blank controls were evaluated using spectrophotometer NanoDrop (Thermo Scientific, ThermoFisher Scientific) with 1.5–2 µL of DNA sample and elution buffers from DNA extraction kits as a background.

IMA, PAC, 5-FU, and methanol, were obtained from Sigma-Aldrich (Munich, Germany). HSA and AGP were obtained from Sigma-Aldrich (Steinheim, Germany). FLU sodium salt was purchased from Toronto Research Chemicals (Toronto, ON, Canada). Flucloxacillin-13C4-14N sodium salt (FLU-13C4-14N) was from Alsachim (Illkirch, France). Sterile water was purchased from B. Braun Melsungen AG (Melsungen, Germany). All reagents used were of the highest available analytical grades. Drug free human plasma was obtained from the Blood Donors’ Center in Regensburg (Haema, Regensburg, Germany).