Agpath id one step rt pcr reagent

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, France

The AgPath-ID One-Step RT-PCR Reagents are a set of reagents designed for one-step reverse transcription and polymerase chain reaction (RT-PCR) analysis. The reagents enable the conversion of RNA into complementary DNA (cDNA) and the subsequent amplification of specific target sequences in a single reaction. The kit includes necessary components such as reverse transcriptase, DNA polymerase, and buffers to facilitate the RT-PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RT-PCR reagents (13 citations) AgPath-IDTM One-Step RT-PCR reagents (6 citations) Step One PCR (2 citations)

84 protocols using agpath id one step rt pcr reagent

Sensitive Zika Virus Quantification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Virus detection from leg, wing and body samples was carried out using 1/10 and 1/100 dilutions in 96-well plates containing a Vero cell monolayer. Saliva samples were titrated directly in 96-well plates in a Vero cell monolayer. Vero cells were maintained with DMEM supplemented with 2% FCS and 2% of penicillin/streptomycin/nystatin (1000 U/ml, 10 mg/ml and 500 U/ml, respectively; Sigma-Aldrich) and incubated for seven days at 37 °C and 5% CO₂ until cytopathic effect observation.
Prior to viral RNA extraction, the samples were homogenized using a TissueLyser II (Qiagen GmbH, Hilden, Germany) at 30 Hz for 1 min. Viral RNA was extracted from the samples using NucleoSpin^® RNA Virus (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. Zika RNA was detected by reverse-transcription quantitative PCR (RT-qPCR) using the primers ZIKA 1086 and ZIKA 1162c defined previously [32 (link)] and AgPath-ID™ One-Step RT-PCR reagents (Applied Biosystems, Foster City, CA, USA). The nucleic acids were detected with a Real-Time PCR 7500 Fast System (Applied Biosystems) with the following amplification protocol: 45 °C for 10 min; 95 °C for 10 min; then 45 cycles at 95 °C for 15 s and at 60 °C for 45 s. The RT-qPCR sensibility was 0.451 TCID₅₀/reaction for detection of MR766 and 0.035 TCID₅₀/reaction for Suriname ZIKV strains.

Núñez A.I., Talavera S., Aranda C., Birnberg L., Rivas R., Pujol N., Verdún M., Failloux A.B, & Busquets N. (2019). European Aedes caspius mosquitoes are experimentally unable to transmit Zika virus. Parasites & Vectors, 12, 363.

+ Open protocol

+ Expand

Real-Time RT-PCR for Respiratory Viruses

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individual real-time RT-PCR (IRTP) was carried out using AgPath-ID One-Step RT-PCR Reagents (Applied Biosystems). The TAC assays were compared with the cognate IRTP assays on 96-well plates under the same thermocycling conditions using the same PCR Master Mix and 5 µL of total nucleic acids as a template. Specimens were tested in duplicates for the presence of adenoviruses, hMPV, influenza A and B viruses, parainfluenza virus types 1-3, and respiratory syncytial virus. In addition, each clinical specimen was tested for the human ribonuclease protein gene to measure the nucleic acid integrity and confirm the sample adequacy. A qRT-PCR test result was considered positive if an exponential fluorescence curve was produced that crossed the assigned cycle threshold at <40.0.

Njuguna H.N., Zaki S.R., Roberts D.J., Fligner C.L., Keating M.K., Rogena E., Walong E., Gachii A.K., Maleche-Obimbo E., Irimu G., Mathaiya J., Orata N., Lopokoiyit R., Maina J., Emukule G.O., Onyango C.O., Gikunju S., Owuor C., Kinuthia P., Bunei M., Fields B., Widdowson M.A., Mott J.A, & Chaves S.S. (2019). Determining the Cause of Death Among Children Hospitalized With Respiratory Illness in Kenya: Protocol for Pediatric Respiratory Etiology Surveillance Study (PRESS). JMIR Research Protocols, 8(1), e10854.

+ Open protocol

+ Expand

Quantification of Viral RNA by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The amount of viral RNA was determined by real time RT-PCR. Supernatant and cell pellet were collected at 24 h.p.i. The collected supernatant was briefly centrifuged to remove cell debris. RNA was extracted from the supernatant and cells using a Qiagen RNeasy mini kit according to the manufacturer’s instructions. RSV RNA was assayed by a real-time RT-PCR using AgPath-ID™ One-Step RT-PCR Reagents and the Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies Corporation, Carlsbad, CA, USA) as previously described [50 (link)]. The primers and probes for the RSV matrix (M) gene (forward primer, 5′-GGC AAA TAT GGA AAC ATA CGT GAA-3′; reverse primer, 5′-TCT TTT TCT AGG ACA TTG TAY TGA ACA G-3′; probe, 5′-6-carboxyfluorescein (FAM)-TGT CCG TCT TCT ACG CCC TCG TC-black hole quencher 1 (BHQ-1)-3′) were obtained from Integrated DNA Technologies (IDT) (Coralville, IA, USA) [50 (link)]. The cycle threshold (C_T) values, the number of cycles required to exceed the background level, were calculated. Inverse C_T values (1/C_T) were used to express the relative amount of RNA extracted from the cells or supernatant of the infected cells [20 (link)].

Ke Z., Dillard R.S., Chirkova T., Leon F., Stobart C.C., Hampton C.M., Strauss J.D., Rajan D., Rostad C.A., Taylor J.V., Yi H., Shah R., Jin M., Hartert T.V., Peebles RS J.r., Graham B.S., Moore M.L., Anderson L.J, & Wright E.R. (2018). The Morphology and Assembly of Respiratory Syncytial Virus Revealed by Cryo-Electron Tomography. Viruses, 10(8), 446.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR for Viral Load Quantification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the frozen brain stem using the High Pure RNA Tissue Kit (Roche Molecular Biochemicals, GmbH, Mannheim, Germany). Approximately 30 mg of tissue was homogenized using a homogenization pestle, and RNA was extracted according to the manufacturer’s recommendations. Then, 50 μL of RNA was eluted and stored at −30°C in a low-temperature freezer until further use. For real-time RT-PCR, the LN34 assay was performed using AgPath-ID One-step RT-PCR Reagents (Applied Biosystems, Foster City, CA, USA) [41 (link)–43 ]. The master mix consisted of the following: 6.5 μL of ddH₂O, 12.5 μL of 2× RT buffer, 1 μL of 25× RT-PCR Enzyme Mix, 1 μL of either LN34 or beta-actin primer sets (10 μM), 1 μL of either LN34 or beta-actin probe (5 μM), and 2 μL of RNA template [41 (link)–43 ]. The sealed plate was placed into an ABI Step One Plus Real-Time PCR (Applied Biosystems Foster City, CA, USA), and the following conditions were set: reverse transcription at 50°C for 30 min, denaturation at 95°C for 10 min, and amplification of 45 cycles at 94°C for 15 s and 56°C for 30 s using ABI7500-standard mode. To estimate viral load, the Cq values were divided into >25 (low copy numbers), 15–25 (high copy numbers), and <15 (very high copy numbers).

Kimitsuki K., Saito N., Yamada K., Park C.H., Inoue S., Suzuki M., Saito-Obata M., Kamiya Y., Manalo D.L., Demetria C.S., Mananggit M.R., Quiambao B.P, & Nishizono A. (2020). Evaluation of the diagnostic accuracy of lateral flow devices as a tool to diagnose rabies in post-mortem animals. PLoS Neglected Tropical Diseases, 14(11), e0008844.

+ Open protocol

+ Expand

Avian Influenza Virus Detection in Birds

Check if the same lab product or an alternative is used in the 5 most similar protocols

All tracheal and cloacal swabs collected in live birds of houses 3 and 1 were sent to the diagnostic laboratory (National Reference Centre for Avian Influenza in Istituto Zooprofilattico Sperimentale delle Venezie) and submitted for Avian Influenza Virus Type A (AIV) rRT-PCR [6 (link)]. Briefly, swabs were individually moved into single tubes, containing a sufficient amount of PBS (with antibiotics) to ensure their full immersion (1 mL), thus swabs suspensions were vortexed for 30 s and centrifuged for 2 min at 15,000× g and the supernatant harvested for RNA extraction.
RNA extraction and Real-Time RT-PCR for AIV: nucleic acid extraction was performed using QIAsymphony DSP Virus/Pathogen Kit (Qiagen, Hilden, Germany) or MagMAX Pathogen RNA/DNA Kit (Applied Biosystems, Waltham, MA, USA) on the QIAsymphony SP instrument (Qiagen) and KingFisher Flex Magnetic Particle Processor (Thermofisher Scientific, Waltham, MA, USA), respectively. Amplification reaction was assembled with the AgPath-ID One-Step RT-PCR Reagents (Applied Biosystems), using CFX 96 Deep well Real-Time PCR System, C1000 Touch (Biorad, Hercules, CA, USA) as platform.

Gobbo F., Zanardello C., Bottinelli M., Budai J., Bruno F., De Nardi R., Patregnani T., Catania S, & Terregino C. (2022). Silent Infection of Highly Pathogenic Avian Influenza Virus (H5N1) Clade 2.3.4.4b in a Commercial Chicken Broiler Flock in Italy. Viruses, 14(8), 1600.

+ Open protocol

+ Expand

SARS-CoV-2 RT-qPCR Detection Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sequences of primers and probes, provided by the WHO, used in RT-qPCR^{2 (link)} are shown in Table 1. AgPath-ID one-step RT-PCR reagents (Applied Biosystems, Foster City, CA, USA) were used in accordance with the manufacturer’s instructions. The viral RNA sample (5 µL) was mixed with the RT-PCR reagents and the corresponding RdRp or E gene primers (1 µL, 10 pmol) and probe (0.5 µL , 10 pmol). PCR was performed at 50 °C for 30 min, 95 °C for 10 min, 95 °C for 15 s, and 60 °C for one min, for 40 cycles; carboxyrhodamine (ROX) was used as a passive reference dye. The Applied Biosystems 7500 Fast Real-Time PCR System was used for RT-qPCR, and the cycle threshold (Ct) value of the SARS-CoV-2 target gene was ascertained (Table 1).Table 1

Primers and probes used to detect SARS-CoV-2.

	Primer/Probe	Sequence (5'–3')
RdRp gene	RdRp_SARSr-F2	GTGARATGGTCATGTGTGGCGG
	RdRp_SARSr-R1	CARATGTTAAASACACTATTAGCATA
	RdRp_SARSr-P2	FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ
E gene	E_Sarbeco_F1	ACAGGTACGTTAATAGTTAATAGCGT
	E_Sarbeco_R2	ATATTGCAGCAGTACGCACACA
	E_Sarbeco_P1	FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ

R is G/A; FAM, 6-carboxyfluorescein; BHQ, black hole quencher.

Chung Y.S., Lee N.J., Woo S.H., Kim J.M., Kim H.M., Jo H.J., Park Y.E, & Han M.G. (2021). Validation of real-time RT-PCR for detection of SARS-CoV-2 in the early stages of the COVID-19 outbreak in the Republic of Korea. Scientific Reports, 11, 14817.

+ Open protocol

+ Expand

Tick-Borne Encephalitis Virus Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ticks were pooled according to development stage, sex, and sampling site, so that each pool contained a maximum of 6 ticks. The 11 larvae were pooled all together. A total of 408 tick pools were prepared and homogenized in 500 µL of Minimum Essential Medium (MEM, Gibco^TM Thermo Fisher Scientific, Waltham, MA, USA) using 2 stainless steel beads (5 mm, Qiagen^®) and a tissue lyser (TissueLyser II, QIAGEN^®) for 5 min at 25 Hz. After centrifugation for 1 min at 10,000 rpm, 200 µL of tick homogenate was harvested for RNA extraction. RNA from tick homogenates was extracted using the IndiMag^® Pathogen Kit (Indical Bioscience, Leipzig, Germany) following the manufacturer’s protocol. Five microliters of eluted RNA (from individual extracts) was used to assess the presence of TBEV RNA by qPCR, as described by [36 (link)]. All samples were also tested for the presence of Ixodes ricinus β-actin as an extraction control. In each run, negative extraction and negative and positive amplification controls were also included. All qPCRs were carried out on a LightCycler 480 Real-Time PCR system (Roche, Basel, Switzerland) using the AgPath-ID™ One-Step RT-PCR Reagents (Applied Biosystems^TM, Thermo Fisher Scientific, Waltham, MA, USA).

Adjadj N.R., Vervaeke M., Sohier C., Cargnel M, & De Regge N. (2022). Tick-Borne Encephalitis Virus Prevalence in Sheep, Wild Boar and Ticks in Belgium. Viruses, 14(11), 2362.

+ Open protocol

+ Expand

Quantification of EV71 RNA in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from Vero cells and pancreata of mice using a QIAamp^® viral RNA mini kit (Qiagen, Hilden, Germany). Taqman real-time PCR and reverse transcription PCR were carried out using AgPath-ID™ One-Step RT-PCR Reagents (Applied Biosystems, Waltham, MA, USA) and a Bio-Rad CFX96 thermal cycler (Bio-Rad, Hercules, CA, USA). The EV71 5′ noncoding region (NCR) of the gene was detected using qRT-PCR. The following EV71 5′NCR primers were used: forward primer 5′-GCGATTGTCACCATWAGCAGYCA-3,’ reverse primer 5′-GGCCCCTGAATGCGGCTAATCC-3,’ and probe primer 5′-CCGACTACTTTGGGWGTCCGTGT-3′. The following GAPDH primers were used: forward primer 5′-GGTCTCCTCTGACTTCAACA-3′, reverse primer 5′-AGCCAAATTCGTTGTCATAC-3′, and probe primer 5′-CCCTCAACGACCACTTTGTCAAG-3′. The cycling conditions were as follows: heating at 45 °C for 10 min for reverse transcription, reverse transcription inactivation, and initial denaturation at 95 °C for 10 min, followed by 40 cycles of amplification at 95 °C for 15 s and at 62 °C for 45 s. The results were analyzed using the real-time system AB 7900HT software (Life Technologies) and all values were normalized to GAPDH levels. A Bio-Rad CFX96 thermal cycler was used at the Core Facility for Innovative Cancer Drug Discovery (CFICDD) at Kangwon National University.

Song J.H., Mun S.H., Yang H., Kwon Y.S., Kim S.R., Song M.Y., Ham Y., Choi H.J., Baek W.J., Cho S, & Ko H.J. (2023). Antiviral Mechanisms of Saucerneol from Saururus chinensis against Enterovirus A71, Coxsackievirus A16, and Coxsackievirus B3: Role of Mitochondrial ROS and the STING/TKB-1/IRF3 Pathway. Viruses, 16(1), 16.

+ Open protocol

+ Expand

SARS-CoV-2 RNA Extraction and Detection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the entire validation process, nucleic acids were isolated using the QIAsymphony DSP Virus/Pathogen Midi kit (Qiagen, Hilden, Germany) on a QIAsymphony SP instrument (Qiagen, Hilden, Germany) (sample volume 300 μL; custom protocol), unless otherwise specified. During the lysis phase, all the samples were spiked with an exogenous internal control (intype IC-RNA, Indical Bioscience GmbH, Leipzig, Germany) to reproduce routine laboratory conditions as foreseen by the upstream AIV screening method adopted at the IZSVe [60 (link),61 (link)] that employs the same nucleic acids.
Amplification reaction was assembled with the AgPath-ID One-Step RT-PCR Reagents (Applied Biosystems, Waltham, MA, USA), 400 nM primer for, 200 nM each primer rev, 200 nM probe, 20 units RNase inhibitor and 5 μL template, in a final volume of 25 μL. Thermal cycling was performed on a CFX96 Deep Well Real-Time PCR System, C1000 Touch (Biorad, Hercules, CA, USA), as follows: 50 °C for 10 min, 95 °C for 10 min, followed by 45 cycles at 95 °C for 15 s, 54 °C for 30 s and 72 °C for 15 s. Data were analyzed using Bio-Rad CFX Manager software (Version 3.1) (Biorad, Hercules, CA, USA), with fluorescence drift correction for the baseline adjustment and single threshold manually set above the background noise (c.ca 50 RFU).

Panzarin V., Marciano S., Fortin A., Brian I., D’Amico V., Gobbo F., Bonfante F., Palumbo E., Sakoda Y., Le K.T., Chu D.H., Shittu I., Meseko C., Haido A.M., Odoom T., Diouf M.N., Djegui F., Steensels M., Terregino C, & Monne I. (2022). Redesign and Validation of a Real-Time RT-PCR to Improve Surveillance for Avian Influenza Viruses of the H9 Subtype. Viruses, 14(6), 1263.

+ Open protocol

+ Expand

WNV RNA Detection and Lineage Determination

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue samples were mechanically homogenised using polypropylene pestles and viral RNA was extracted using NucleoSpin^® RNA Virus (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. RNA was eluted in a final volume of 50 μL of RNase-free water. WNV RNA was detected by real-time reverse transcription PCR (RT-PCR) using the primers and probe previously described [26 (link)] and AgPath-ID™ One-Step RT-PCR reagents (Applied Biosystems, Foster City, CA, USA). The amplification was detected using a Real-Time PCR 7500 Fast System (Applied Biosystems) with the following thermal profile: 48 °C for 10 min; 95 °C for 10 min; and then 45 cycles at 95 °C for 15 s and at 60 °C for 60 s. Further analysis of a partial sequence of the NS5 gene, using the primers and RT-PCR conditions previously described by Scaramozzino et al. [27 (link)], were performed in the encephalon samples to determine the WNV lineage.

Aguilera-Sepúlveda P., Napp S., Llorente F., Solano-Manrique C., Molina-López R., Obón E., Solé A., Jiménez-Clavero M.Á., Fernández-Pinero J, & Busquets N. (2022). West Nile Virus Lineage 2 Spreads Westwards in Europe and Overwinters in North-Eastern Spain (2017–2020). Viruses, 14(3), 569.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!