Biometra tadvanced

Detection was carried out according to the work of Matsumura et al. (2017). Amplification was performed with 1× DreamTaq Green Buffer (ThermoFisher; Waltham, MA, USA); 0.2 mM dNTP (Promega; Madison, WI, USA); the primers listed in Table 4, each 0.5 pmol; 1U Taq DNA polymerase (ThermoFisher; Waltham, MA, USA); and 2 μL of template DNA, with a total volume of 25 μL. DNA was amplified using the Biometra TAdvanced (Analytik Jena; Jena, Germany) with a thermal protocol consisting of predenaturation at 98 °C for 2 min, which was followed by 30 cycles of 98 °C for 10 s, 57 °C for 20 s, and 72 °C for 40 s, and final polymerization at 72 °C for 3 min. PCR products were loaded on 2% agarose gel stained with GoodView Nucleic Acid Stain (SBS Genetech; Beijing, China) and visualized under UV light [10 (link)].

Ipsilateral lumbar 4–5 (L_4–5) spinal dorsal horn tissues of rats were isolated and stored in −80°C refrigerator temporarily on the 14th day after surgery. Total RNA was extracted using the TRIzol method (TransGen Biothch, Beijing, China). Total RNA (2 μg) was converted to cDNA using Biometra TAdvanced (Analytik Jena AG, Jena, Germany). The primers were designed and purchased from Invitrogen (Thermo Fisher Scientific, CA, USA), and the sequences were as follows: β‐actin, forward 5′‐TAAAGACCTCTATGCCAACACAGT‐3′ and reverse 5′‐CACGATGGAGGGGCCGGACTCATC‐3′; P2X4, forward 5′‐AGACACTGCTGTGGCTTAGG‐3′ and reverse 5′‐GCTGACAGCACCTGAGAGAG‐3′; LOC100911498 forward 5′‐TGTTGGGACAGCTTTATCAG‐3′ and reverse 5′‐GCAGGTAGCCTTCATTTGG‐3′. PCR was performed with the SYBR Premix Ex Taq II (Takara Bio Inc., Kusatsu, Japan) in an ABI‐Prism 7500 Sequence Detection System (Applied Biosystems, CA, USA). Relative concentrations of mRNAs were calculated on the basis of threshold cycle values and corrected by β‐actin expression. The result was measured following to the comparative 2^−△△CT method.

Genomic DNA was extracted from white blood cells using the salting out method [20 ].
The concentration of extracted DNA was measured using Nanodrop spectrophotometer (ND-1000, ThermoFisher Scientific, Wilmington, USA). It was then frozen at − 70 °C to be used for subsequent experiments. Genotypes of CD36-rs1761667 polymorphism were determined using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method as described below.
The SNP was detected by PCR using following primers: 5′- CAAGGTCTGGTATCCACCTGTT − 3′ (forward), 5′- ATGAAGCTTCCCGCCTTAGAA − 3′ (reverse) and amplification was carried out using a Biometra T advanced (Analytik Jena, Germany). PCR conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of amplification including denaturation at 95 °C, annealing at 60 °C, extension at 72 °C (each comprising 30 s), and the final extension at 72 °C for 5 min. PCR products (10 μl) were digested with HhaI restriction endonuclease (Thermo Scientific, USA) at 37 °C for 16 h and fragments were separated by agarose gel electrophoresis (1.5% agarose) stained with ethidium bromide. Afterwards, being observed by ultraviolet light (UV Tec Cambridge Gel doc), three genotypes of CD36-rs1761667 were detected which include: GG (161 and 264 bp), GA (161, 245, and 425 bp), and AA (425 bp).