Mice were genotyped for WT or 5xFAD status by PCR as previously described [13 (link)]. Briefly, DNA from ear punches collected at P30 was extracted using a kit (Extract-N-Amp™, Sigma-Aldrich) and amplified for PCR using the 2× PCR Bio HS Taq Mix Red enzyme (PCR Biosystems) with the following primers (5′–3′): APP forward: AGGACTGACCACTCGACCAG; APP reverse: CGGGGGTCTAGTTCTGCAT; PSN1 forward: AATAGAGAACGGCAGGAGCA; PSN1 reverse: GCCATGAGGGCACTAATCAT; WT APP forward: CTAGGCCACAGAATTGAAAGATCT; WT APP reverse: GTAGGTGGAAATTCTAGCATCATCC.
Extract n amp
Manufactured by Merck Group
Sourced in Germany
Extract-N-Amp is a laboratory product designed for the extraction and amplification of DNA samples. It provides a streamlined process for isolating and purifying DNA from a variety of biological samples. The core function of Extract-N-Amp is to enable efficient DNA extraction and subsequent amplification, which are essential steps in various molecular biology applications.
Automatically generated - may contain errors
7 protocols using extract n amp
1
Genotyping 5xFAD Alzheimer's Mouse Model
2
Lphn3 Mutant Mouse Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice originated from a colony of Lphn3 (129S4/Sylvae and C57 mixed background) (Gene ID: 319387) mutant mice maintained by heterozygous matings. All animals were genotyped from genomic DNA isolated from tails collected at weaning using Extract‐N‐Amp (Sigma Aldrich, St. Louis, MO). Details regarding the genotype, age, and sex of mice in all cohorts are provided in Table S1. Mice that were tested in the food motivation and working memory tasks were singly housed in order to closely monitor food intake and body weight, and maintained on a 12 h light/dark cycle (on at 7:00) with free access to water at all times. During behavioral testing, these mice were food‐restricted to 85–90% of their free‐feeding body weight with their target weights adjusted upward every week by 1 g to account for growth. For the remaining behavioral assays and molecular experiments, mice were housed in groups of 5/cage in an animal room at 20–22°C, under a 12‐h light/dark cycle (on at 7:00) with ad libitum access to food and water. Mice were killed by CO2 asphyxiation and cervical dislocation prior to tissue collection.
3
Genotyping Transgenic Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were genotyped for WT, 5×FAD or Gal3 by PCR as described previously [27 (link)]. Briefly, DNA from ear punches was extracted using the extraction kit (Extract-N-Amp™, Sigma-Aldrich, Schnelldorf, Germany) and amplified by PCR using the 2× PCR Bio HS Taq Mix Red enzyme (PCR Biosystems, Techtum, Nacka, Sweden), with the following primers (5′–3′): For 5×FAD mice: App (Forward AGGACTGACCACTCGACCAG; Reverse CGGGGGTCTAGTTCTGCAT); Psn1 (Forward AATAGAGAACGGCAGGAGCA; Reverse GCCATGAGGGCACTAATCAT; WT: App (Forward CTAGGCCACAGAATTGAAAGATCT; Reverse GTAGGTGGAAATTCTAGCATCATCC). For Gal3KO mice: Gal3 (Forward: CACGAACGTCTTTTGCTCTCTGG); Gal3−/− Reverse: GCTTTTCTGGATTCATCGACTGTGG; Gal3+/+ Reverse: TGAAATACTTACCGAAAAGCTGTCTGC.
4
Genotyping of 5xFAD Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotypes of 5xFAD mice were determined using an integrated extraction and amplification kit (Extract-N-Amp™, Sigma-Aldrich). First, the samples were incubated at 94 °C for 5 mins, followed by 40 cycles with denaturation at 94 °C for 45 sec, annealing at 55 °C for 30 sec, and elongation at 72 °C for 1.5 mins. The following primers (CyberGene, Solna, Sweden) were used: For the 5xFAD the primers (5′ to 3′) used are listed below: APP Forward AGGACTGACCACTCGACCAG, APP Reverse CGGGGGTCTAGTTCTGCAT, PSN1 Forward AATAGAGAACGGCAGGAGCA, PSN1 Reverse GCCATGAGGGCACTAATCAT, WT APP Forward CTAGGCCACAGAATTGAAAGATCT, WTT APP Reverse GTAGGTGGAAATTCTAGCATCATCC, RD1, RD2 and RD3 AAGCTAGCTGCAGTAACGCCATTT,ACCTGCATGTGAACCCAGTATTCTATC, CTACAGCCCCTCTCCAAGGTTTATAG. The PCR products were separated by gel electrophoresis labelled with ethidium bromide and visualized using a CCD camera (SONY, Tokyo, Japan).
5
Genotyping of Galectin-3 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotype of gal3−/− and gal3+/+ mice was determined by an integrated extraction and amplification kit (Extract-N-Amp™, Sigma-Aldrich). The PCR consisted of 94°C for 5 min, then 40 cycles with denaturation at 94°C for 45 sec, annealing at 55°C for 30 sec, and elongation at 72°C for 1.5 min. The primers (CyberGene, Solna, Sweden) used were as follows: galectin-3 common 5-CAC GAA CGT CTT TTG CTC TCT GG-3’), gal3−/− 5-GCT TTT CTG GAT TCA TCG ACT GTG G-3’ (single band of 384 bp) and gal3+/+ 5-TGA AAT ACT TAC CGA AAA GCT GTC TGC-3’ (single band of 300 bp) [41 (link)]. We separated the PCR products by gel electrophoresis labeled with ethidium bromide and visualized in a CCD camera (SONY, Tokyo, Japan).
6
Genotyping Gal3 and 5xFAD Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotypes of Gal3−/− (KO) and Gal3+/+ (WT) mice were determined using an integrated extraction and amplification kit (Extract-N-Amp™, Sigma-Aldrich). First, the samples were incubated at 94 °C for 5 min, followed by 40 cycles with denaturation at 94 °C for 45 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 1.5 min. The following primers (CyberGene, Solna, Sweden) were used: galectin-3 common (5′-CAC GAA CGT CTT TTG CTC TCT GG-3′), galectin-3−/− (5′-GCT TTT CTG GAT TCA TCG ACT GTG G-3′, single band of 384 bp) and galectin-3+/+ (5′-TGA AAT ACT TAC CGA AAA GCT GTC TGC-3′, single band of 300 bp) [17 (link)]. For the 5xFAD mice, the primers (5′–3′) used are listed below: APP Forward AGGACTGACCACTCGACCAG, APP Reverse CGGGGGTCTAGTTCTGCAT, PSN1 Forward AATAGAGAACGGCAGGAGCA, PSN1 Reverse GCCATGAGGGCACTAATCAT, WT APP Forward CTAGGCCACAGAATTGAAAGATCT, WTT APP Reverse GTAGGTGGAAATTCTAGCATCATCC, RD1, RD2 and RD3 AAGCTAGCTGCAGTAACGCCATTT ACCTGCATGTGAACCCAGTATTCTATC, CTACAGCCCCTCTCCAAGGTTTATAG. The PCR products were labeled with SYBR® Green (Sigma-Aldrich), separated by gel electrophoresis and visualized using a CCD camera (SONY, Tokyo, Japan).
7
Rapid Genomic DNA Extraction and Fragment Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA extractions were performed with Extract-N-Amp or REDExtract-N-Amp™ Tissue PCR Kits (Sigma-Aldrich). Whole embryos or adult zebrafish fin-clips were lysed by incubation in a mixture of 50 µL extraction solution (Extraction Solution E7526) and 14 µL tissue preparation solution (Tissue Preparation Solution T3073) at room temperature for 10 min, 95°C for 5 min, 25°C for 5 min and then neutralized with 50 µL of neutralization solution (Neutralization Solution B N3910). Aliquots from these lysates were used for a PCR (with a Taq DNA polymerase with standard Taq buffer NEB or EconoTaq DNA polymerase Lucigen) with respective gene primers and an 18mer M13F-FAM fluorescent tagged primer (5'-TGTAAAACGACGGCCAGT-3') in a PCR condition: 94°C (12min) denaturation, 35 cycles of amplification (94°C for 30 sec, 57°C for 30 sec, 72°C for 30 sec), and a final extension at 72°C for 10 min, and indefinite hold at 4°C. Genetic fragment analyses to identify mutant amplicons generated by insertion or deletion were performed on a 3130xI Genetic Analyzer (Applied Biosystems Hitachi) and the data was analyzed in a GeneMapper v.4.0 as per protocol described (Varshney et al., 2015) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!