Topo ta
The TOPO TA is a cloning kit designed for the rapid and efficient insertion of PCR products into plasmid vectors. It utilizes a topoisomerase I-based cloning method, allowing for fast, one-step cloning without the need for ligase or restriction enzymes.
Lab products found in correlation
71 protocols using topo ta
Molecular Cloning and Sequencing of MMTV env-pol
Methylation analysis of plant genomic DNA
Genotyping and Phenotyping of Mismatch Repair Knockout Mice
Expression of Small RNA Constructs
Individual RNAs were synthesised from these templates by in vitro transcription using SP6 RNA polymerase (Christov et al., 2006 (link); Gardiner et al., 2009 (link)). RNAs were purified by anion exchange chromatography (Zhang et al., 2011 (link)). The size and purity of all in vitro synthesised RNA was confirmed by 8 M urea denaturing polyacrylamide gel electrophoresis and staining with SYBR Gold (Invitrogen). Multimeric 100-nucleotide RNA molecules (Fermentas) were used as molecular mass markers.
Oligonucleotide Deamination by rA3A
Quantitative mRNA Expression Assay
Generating DIG-Labeled RNA Probes
wu:fc46h12_left1:CTGCTGACCTTCACCCTGATTCTG, wu:fc46h12_right1:GGTGTATTGCCTAAAACCCTCAGC wu:fc46h12_left2:ATTGCTGCTGACCTTCACCCTGAT, wu:fc46h12_right2:ATTGCCTAAAACCCTCAGCTTCCA.
Transcriptome Splice Site Validation
Bisulfite Sequencing of Plant DNA
EBV lmp-1 Amplicon Sequencing
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!