Mulv reverse transcriptase
MuLV reverse transcriptase is an enzyme that catalyzes the synthesis of complementary DNA (cDNA) from a single-stranded RNA template. It is used in molecular biology applications such as reverse transcription-polymerase chain reaction (RT-PCR) and cDNA library construction.
Lab products found in correlation
25 protocols using mulv reverse transcriptase
Quantifying CLK1 and OGT Expression
Quantifying miRNA Expression Changes Using RT-PCR
Quantitative RT-PCR Analysis of Gene Expression
forward primer 5′ACCATCTTCCAGGAGCGAGA3′ and
reverse primer 5′GGCCATCCACAGTCTTCTGG 3′ for GAPDH mRNA,
forward primer 5′TCAGCCAATCTTCATTGCTC3′ and
reverse primer 5′GCCATCAGCTTCAAAGAACA3′ for IL-1β pre-mRNA (Siu et al., 2019 (link)),
forward primer 5′CGAATCCCACTGTGATATGCC3′ and
reverse primer 5′GTGTGTAGCGTTTGTTGAGGC3′ for NLRP3 mRNA.
cDNA Synthesis and miRNA qPCR Protocol
[10 (link)]. Briefly, single tube poly (A) synthesis and reverse transcription was performed with 100 ng of RNA in a final volume of 10 μl combined with 1 μl MuLV reverse transcriptase (New England Biolabs), 1 μl of poly (A) polymerase (New England Biolabs), 1 μl 10x poly (A) polymerase buffer, 1 μl 0.1 mM ATP, 1 μl 10 μM RT-primer (5′-CAGGTCCAGTTTTTTTTTTTTTTTVN where V is A, C and G and N is A, C, G and T). The reaction was incubated at 42°C for 1 hour followed by enzyme inactivation at 95°C for 5 minutes. A panel of three technical cDNA replicates for each of the three biological samples per condition was constructed. The cDNA was diluted 5× before used in qPCR reactions.
miR-specific qPCR was performed as previously described in
[16 (link)]. Briefly, 0.25 μl of 10 μM miRNA specific forward and 0.25 μl of 10 μM miRNA specific reverse primer, 5 μl of 2× LightCycler 480 SYBRGreen I Mastermix (Roche) and 3.5 μl of RNAse free H2O and 1 μl of cDNA of each samples was combined in 10 μl reaction and subjected to qPCR performed on LightCycler 480 (Roche).
RNA Extraction and qRT-PCR Analysis
RNA Extraction and cDNA Synthesis
Quantitative PCR Transcript Abundance
Reverse Transcription for Various RNA Types
For miRNAs, cDNA was synthesized based on a published protocol [68 (link)]. Briefly, the 10 µL reaction, which included 1 µg RNA, 1 µL of 10X poly(A) polymerase buffer (New England Biolabs, Ipswich, MA, USA), 0.25 mM ATP, 1 mM dNTPs (New England Biolabs, USA), 1 µM RT-primer (GGTCCAGTTTT TTTTTTTTTTTVN (V is A, C, and G; N is A, C, G, and T)), 80 U MuLV reverse transcriptase (New England Biolabs, USA), and 0.75 U poly(A) polymerase (New England Biolabs, Ipswich, MA, USA) were subjected to 42 °C for 1 h, followed by enzyme inactivation at 95 °C for 5 min.
RNA Extraction and cDNA Synthesis
Detailed RNA Extraction and cDNA Synthesis
For mRNA analysis two cDNA replicates were made from 100 ng RNA for each sample in a final volume of 10 μl including 0.25 μg 3:1 mixture of random hexamers/OligodT, 2 μl Improm-II buffer, 2 mM dNTP mix, 10 units RNasin Ribonuclease inhibitor, 1.25 mM MgCl2 and 0.5 μl Improm-II reverse transcriptase (Promega), which were incubated for 42°C for 1 hour and 15 min at 70°C following manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!