Nanodrop uv spectrophotometer

All tumor samples were collected from surgical resection specimens. Hematoxylin-Eosin stained slides were reviewed by a pathologist (H.S.L.). Tumor areas were identified, and more than 1 × 1 cm area, which contained more than 60% tumor cells, was microscopically dissected. One or two 8-μm-thick formalin-fixed paraffin-embedded (FFPE) tumor tissue sections were deparaffinized. DNA was isolated using cobas^® DNA Sample Preparation Kit (Roche, Branchburg, NJ, USA). Concentration of the isolated DNA was measured using NanoDrop UV spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). The isolated DNA was diluted using DNA specimen diluent provided in cobas^® 4800 Mutation Test Kit (Roche) to an optimal concentration of 2 ng/μL. Amplification and detection were performed using automated cobas^® X480 analyzer (Roche). Real-time polymerase chain reaction (PCR) detected mutations in exons 1, 4, 7, 9, and 20 of PIK3CA. Results of real-time PCR are reported using the following 12 categories: (1) E542K, (2) N345K, (3) H1047X (L, R, or Y), (4) E545X (A, D, G, or K), (5) C420R, (6) G1049R, (7) Q546X (K, R, E, or L), (8) R88Q, (9) M1043I, (10) mutation not detected, (11) invalid (sample out of range/control failure), and (12) failed (hardware/software failure).

The primary hepatocytes were lysed using the AG RNAex Pro regent (Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China) for 5 min at room temperature. Then, total RNA was extracted from the lysis using a SteadyPure RNA Extraction Kit with reference to the protocols provided by Accurate Biotechnology. Agarose gel electrophoresis was performed to confirm the quality of RNA samples with the purity determined by a Nanodrop UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Then, the first-strand complementary DNA (cDNA) was obtained by reverse transcription from 1 μg of total RNA using an Evo M-MLV RT Kit (Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China). To quantify gene expression, the real-time PCR (RT-PCR) was conducted under the Bio-Rad CFX96 platform (Bio-Rad, Berkeley, CA, USA) using the SYBR Green Pro Taq HS premix acquired from Accurate Biotechnology. The 2^−∆∆Ct method was adopted to calculate the relative transcription with elongation factor 1α (ef1a) used as the housekeeping gene. The high expression stability of ef1a in M. amblycephala was demonstrated in a recent study [32 (link)]. Moreover, the sequences of primers used in the current study are listed in Table 1.

Quantitative real-time polymerase chain reaction (PCR) was performed on c-DNA, derived from FDZ10-mRNA silenced HGC-27, HLF, HUCCT-1, N-87, SW-620 cells, their corresponding negative controls and exosomes, as well as from FDZ10-mRNA silenced cells after their subsequent incubation with exosomes, either with or without the transfection complex. Total RNA was extracted using the miRNeasy Kit in according to the experimental procedure from Qiagen, and after RNA extraction, the purity and the quantity of the nucleic acids were measured with a NanoDrop UV spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). 2 μg of total RNA were reverse transcribed by using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative real time PCR (qPCR) was carried out by means of iTaq™ Universal SYBR^® Green Supermix (Bio-Rad) and the CFX96 Touch™ qPCR System (Bio Rad). The optimized thermal cycling conditions were 95 °C for 2 min, 40 cycles at 95 °C for 5 s and 60 °C for 30 s. Primer sequences: GAPDH FW 5’ GAAGGTGAAGGTCGGAGTCA 3’, GAPDH RV 5’ CATGGGTGGAATCATATTGGA 3’; FZD10 FW 5’ AGCAGGTCTCTACCCCCATC 3’, FZD10 RV 5’ TAATCGGGGAGCACTTGAGC 3’. Real-time PCR results were extrapolated from a standard curve and expressed as target sequence copy number per 1 μL c-DNA.

All samples used in the analysis were from patients suspected to have HHT who were referred to Ambry Genetics from January 2013 to May 2014 for comprehensive HHT testing, which includes full gene-sequencing analysis of SMAD4, ACVRL1 and ENG genes, and deletion/duplication analysis of ACVRL1 and ENG genes. Subjects were excluded from this protocol due to a lack of sufficient DNA or written consent. Of the 93 individuals tested, 5 met at least 3 of 4 Curacao criteria, 23 met 2 and 65 met 1 or less. All individuals used for testing provided written consent and were de-identified before analysis (Solutions Institutional Review Board protocol #1OCT14–93). Clinical and phenotype data were abstracted from the test requisition form, provided by the ordering physician. At least 6–7 μg of genomic DNA was extracted from whole blood or saliva using the QiaSymphony instrument (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Isolated DNA was quantified using a NanoDrop UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) with quality metrics of A260/280 from 1.8 to 2.0 and A260/230 of ⩾1.6.

RNA was isolated from Müller cell pellets using the RNeasy total RNA isolation kit (Qiagen) as per the manufacturer’s instructions. RNA was also isolated from EV for miRNA sequencing and qPCR validation using the Total Exosome RNA Isolation Kit (Invitrogen^™) as per the manufacturer’s instructions. In order to ensure that only EV-encapsulated RNAs were analysed, intact EVs in solution were treated with RNase A enzyme (100 U/mL) (Invitrogen^™, MA, USA) for 15 min at 37°C before the addition of RNase inhibitor (1 U/mL). To confirm that RNA was internalised, an equivalent quantity of EV was pre-treated with a membrane-disrupting detergent (Triton X-100, 0.1% v/v), vortexed briefly, and incubated for 15 min at room temperature prior to the addition of the RNase enzyme. A second control consisting of 1 μg of total cellular RNA recovered from MIO-M1 cells was diluted in an equivalent volume of PBS before receiving the RNase enzyme treatment. Samples were then re-pelleted by ultracentrifugation at 100,000 × g for 90 min at 4°C prior to miRNA isolation. The RNA was purified and analysed using the methods described above. RNA was quantified by a NanoDrop UV spectrophotometer (Nanodrop-1000, Thermo Scientific) before storage at −80°C.

In this study, Mearns fig populations from seven areas, namely Jialeshui, Kenting, Eluanbi (Southern Taiwan), Shiauyeliou, Sansiantai (Eastern Taiwan), Orchid Island, and Green Island, were collected (Figure 1, Table 1 and Table 2). Fifteen individuals of each sex were collected from each population, totaling seven populations and 210 individuals. The genomic DNA of the samples was extracted from mature leaves using the GeneMark Plant Genomic DNA Purification kit (GeneMark Technology Co., Ltd., Tainan, Taiwan). The quality and quantity of the extracted DNA were determined by a Nanodrop UV spectrophotometer (Thermo, Waltham, MA, USA) and stored in the −20 °C freezer.

In parallel, cfDNA was isolated from 2 mL of plasma obtained from each patient (n = 51) at diagnosis, using a Cobas^® cfDNA Sample Preparation Kit (Roche, Branchburg, NJ, USA) and following the manufacturer’s instructions.
A Nanodrop UV spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) was used to verify the quality and quantity of the extracted DNA from both tumor tissue and patient plasma. Amplification and detection were performed with an Automated Cobas z480 analyzer instrument (Roche Molecular System Inc., Pleasanton, CA, USA). The real-time PCR tests examined the most common mutations in codons 12, 13, 59, 61, 117 and 146 in the KRAS and NRAS genes; the V600E BRAF mutation; and in exons 2, 5, 8, 10 and 21 of PIK3CA mutations. The tests to detect these mutations both in tumor tissue and in the patient’s peripheral blood were purchased from Roche (Branchburg, NJ, USA): the KRAS v2 mutation test (LSR), BRAF/NRAS mutation test (LSR) and the Cobas mutation test PIK3CA. Data were analyzed according to the manufacturer’s instructions by uploading the .ixo files to the online LSR Data Analysis tool: https://lifescience.roche.com/en_nl/brands/oncology-research-kits.html (accession on 18 January 2023).