Chromatin conformation capture (3C) analysis was performed as previously described using EcoRI cleavage.33 (link),34 (link) Briefly, stable SIRT1 knockdown and shRNA control K562 cells (2 × 106) were cross-linked with 1% formaldehyde (Sigma) at room temperature for 10 min, followed by glycine quenching, cell lysis and nucleus isolation. The cross-linked DNA was digested by EcoRI (New England Biolabs, Ipswich, MA), intramolecularly ligated with T4 ligases (New England Biolabs) and then reverse cross-linked. Relative crosslinking between the anchor fragment LCR and HBG or HBD promoter were analyzed by SYBR Green real-time qPCR. Interaction between fragments within the α-tubulin gene was used as the internal normalization control for 3C signals. To eliminate variability between samples, interaction frequencies between the anchor fragment and the fragment encompassing the HBG gene from the scrambled shRNA control sample of each experiment were set to one. The primers were determined from the published sequences.33 (link),35
Ecori
Manufactured by Merck Group
Sourced in United States
EcoRI is a type II restriction endonuclease enzyme that recognizes and cleaves the palindromic DNA sequence 5'-GAATTC-3'. It is commonly used in molecular biology and genetic engineering applications.
Automatically generated - may contain errors
7 protocols using ecori
1
Chromatin Conformation Capture in SIRT1 Knockdown
2
Constructing shRNA Targeting DKC1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To insert sequences encoding DKC1 shRNA, the pLKO‐Tet‐On plasmid (Novagen, Cambridge, MA, USA) was digested with AgeI and EcoRI enzymes (Promega, Madison, WI, USA) and then annealed and ligated with two partially overlapping oligonucleotides targeting the junction of DKC1 12–13 exons. Oligonucleotide sequences carrying AgeI and EcoRI sites at their ends were as follows: forward, 5′ CCGGTATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATATTTTT 3′; reverse, 5′AATTAAAAATATGTTGACTACAGTGAGTCTCTCGAGAGACTCACTGTAGTCAACATA 3′ (Sigma‐Aldrich, St. Louis, MO, USA). Competent Stbl4 Escherichia cells (Invitrogen, Carlsbad, CA, USA) were transformed with ligation products, and plasmid DNA from positive clones were sequenced to confirm the identity of the shDKC1 silencing construct, hereafter named pLKO‐Tet‐On‐shDKC1.
3
Multiplex FISH Analysis of Myeloma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FISH analysis was performed on bone marrow (BM) samples using sorted plasma cells. Plasma cells were purified from by Miltenyi technology (anti-CD138 coated magnetic beads, Paris, France) at a purity of more than 95%. The following probes were used in the QM-FISH panel: del(17p) (TP53), del(13q) (RB1), del(16q) (CYLD), del(11q) (cIAP), and 1q21gains (CKS1B). The 5 probes were designed based on the UCSC (University of California, Santa Cruz) genome browser database (http://genome.ucsc.edu/ ). Bacterial artificial chromosome plasmid that targets these 5 genes was extracted using the plasmid purification kit (Qiagen, Hilden, Germany) according to the instructions provided by the manufacturer, digested with EcoRI (Sigma, St. Louis, MO), and purified. The purified DNA probes for del(17p) (TP53), del(13q) (RB1), del(16q) (CYLD), del(11q) (cIAP), and 1q21 gains (CKS1B) were labeled by nick-translation with green dUTP (green, Abbott Molecular, Abbott Park, IL), PromoFluor-555-aadUTP (orange, PromoKine, Heidelberg, Germany), PromoFluor-590-aadUTP (red, PromoKine, Heidelberg, Germany), HyPer5 dCTP (infrared, GE Healthcare), and PromoFluor-415-aadUTP (light blue, PromoKine, Heidelberg, Germany), respectively.11,12 (link) The specificity and sensitivity of these probes were confirmed using human dermal fibroblasts cell line prior to hybridization of MM samples.
4
Optimized Expression of Recombinant Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amino acid sequence of rSNTX was subjected to reverse translation into a nucleic acid sequence using EMBOSS Backtranseq (https://www.ebi.ac.uk/Tools/st/emboss_backtranseq/), with codon usage tailored for E. coli K12 -a widely recognized host organism for recombinant protein expression. To further optimize the genetic construct for robust and e cient protein expression, meticulous gene optimization parameters were subsequently applied. Both the optimized and unmodi ed versions of the rSNTX sequences were scrutinized using the specialized GenScript Rare Codon Analysis Tool (http://www.genscript.com/cgi-bin/tools/rare_codon_analysis). Additionally, the levels of free energy, secondary structure thermodynamics, and mRNA folding were compared before and after gene optimization using The UNAFold Web Server (http://www.unafold.org/mfold/applications/rna-folding-form.php). This analysis demonstrates that the optimization does not signi cantly alter the mRNA structure in a way that affects protein expression. Finally, the trxA and 6x His-tag sequences were added to the N-terminal and C-terminal of the optimized sequence, respectively. SnapGene software was utilized to precisely determine the insertion site for rSNTX, and we selected the EcoRI and XhoI restriction enzymes (Sigma, USA) for subsequent cloning steps.
5
Phage DNA Extraction and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phage DNA was extracted using the chloroform technique; the DNA pellet was then resuspended in RNase/DNase-free water and stored at −20 °C. In this study, the manufacturer’s instructions for digestion were followed, and restriction enzymes HindIII, EcoRI, PaeI, SspI, and NdeI from Sigma Aldrich were used. These enzymes performed this restriction digestion process three times. Finally, this study used 1% TBE (Tris–Borate EDTA) running buffer and 1% agarose gel electrophoresis to study our digestion.
6
Phage DNA Extraction and Restriction Digestion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The phage DNA was extracted using the Viral Nucleic Extraction Kit II (Geneaid, Taipei, Taiwan). The phage DNA was digested with the HindIII, HincII, EcoRI, and NheI restriction enzymes (Sigma Aldrich) according to the manufacturer's protocol. Restriction digestions were repeated three times. The digested DNA was analyzed by 0.8% agarose gel electrophoresis with 0.5% TBE (Tris–Borate EDTA) running buffer [26 ].
7
DNA-Dps Complex Formation and Co-Crystallization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly prepared Milli-Q water was used in the experiments, as well as two types of DNA plasmids. The circular vector pJET12-blunt 3130 bp was isolated as described in [43] (link). The mixture of pSPT18-and pSPT19-neo-DNA (~4500 bp each) cleaved with Eco RI (further referred to as linearized DNA) was obtained from Sigma-Aldrich (USA). Overexpression and purification of E.coli Dps was performed as described in [12] (link). A buffer containing 50 mM NaCl, 50 mM Tris-HCl and 0.5 mM EDTA (pH 8.0) was used for the preparation of DNA-Dps complexes and co-crystals, since it was shown to be most favorable for DNA-Dps co-crystallization [12] (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!