FISH was optimized and performed as described earlier (Hopman et al., 2005 (link); Haugg et al., 2011 (link), 2014 (link)). In brief, full length (5104 bp) MCPyV DNA was cloned into a StrataClone PCR Cloning Vector (pSC-A-amp/kan; Stratagene, Santa Clara, CA). The Plasmid DNA Purification Kit NucleoBond® PC 2000 (Macherey-Nagel, Dueren, Germany) was used to extract MCPyV plasmid DNA and sequenced using T7 and T3 primers. Labeling of the DNA was performed by standard nick translation with Biotin-Nick Translation Mix (Roche, Mannheim, Germany) containing biotin (Bio)-16-dUTPs. The final concentration of the labeled DNA was 2 ng/μl in 50% formamide, 20% dextran sulfate, 2x SSC pH 7.0, 50x excess carrier DNA from salmon sperm (Sigma Chemical, St. Louis, MO) and 50x tRNA from S. cerevisiae (Sigma Chemical, St. Louis, MO).
Biotin nick translation mix
Manufactured by Roche
Sourced in Germany, Switzerland
Biotin-Nick Translation Mix is a laboratory reagent used for labeling DNA. It contains the necessary enzymes and reagents to incorporate biotin-labeled nucleotides into DNA strands through a process called nick translation. This process allows for the detection and visualization of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Dig nick translation mix, by Roche (23 mentions)
Vectashield, by Vector Laboratories (2 mentions)
Anti digoxigenin rhodamine, by Roche (2 mentions)
Anti digoxigenin rhodamine fab fragments, by Roche (2 mentions)
Nucleobond pc 2000, by Macherey-Nagel (1 mentions)
Trna from s cerevisiae, by Merck Group (1 mentions)
Alexa fluor 555, by Thermo Fisher Scientific (1 mentions)
Zen blue edition software, by Zeiss (1 mentions)
Axioskop 2, by Zeiss (1 mentions)
Axiovision, by Zeiss (1 mentions)
Slowfade, by Thermo Fisher Scientific (1 mentions)
Axioimager 2 epifluorescence microscope, by Zeiss (1 mentions)
Rnase a, by Roche (1 mentions)
Kapa hifi hotstart readymix, by Roche (1 mentions)
Plasmid miniprep kit, by Biomiga (1 mentions)
Bx53m, by Olympus (1 mentions)
Doc cam u3 50s5m c, by Molecular Devices (1 mentions)
Axioplan 2 fluorescence microscope, by Zeiss (1 mentions)
Nanovue plus, by GE Healthcare (1 mentions)
Quick spin columns, by Roche (1 mentions)
39 protocols using biotin nick translation mix
1
Optimization and Application of FISH
2
GISH Analysis of Monococcum Metaphase Chromosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GISH analysis of mitotic metaphase chromosomes was performed according to a previously described fluorescence in situ hybridization protocol with minor modifications[33 (link),44 (link)]. Genomic DNA was extracted from young leaves of a T. monococcum ssp. aegilopoides accession, KU-3620. Genomic DNA of KU-3620 was labeled using Biotin-Nick Translation Mix (Roche Diagnostics, Basel, Switzerland), incubated at 16°C for 24 h, and then digested with the restriction enzyme HaeIII at 37°C for 5 h. The biotin-labeled DNA was used as a probe. After chromosomes were incubated in 2× SSC (saline-sodium citrate) buffer including 70% (v/v) formamide at 80°C for 2 min for denaturation, they were hybridized with the biotin-labeled probe. The biotin-labeled probe was visualized using streptavidin-conjugated Alexa Fluor 555 (Life Technologies, Carlsbad, CA, USA). Chromosomes were counterstained with 0.1 μg/ml 4,6-diamino-2-phenylindole (DAPI). GISH signals and DAPI-stained chromosomes were captured using a fluorescence microscope (Axioskop2, Carl Zeiss, Oberkochen, Germany), and images were pseudo-colored and processed using ZEN software blue edition (Carl Zeiss).
3
ACE Detection via FISH Fluorescent Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fluorescence in situ hybridization (FISH) experiments were performed with a standard protocol. The pPur (Clontech, 631601) plasmid was labeled with FITC fluorescent dye and used as a probe for ACE detection. We used the Roche DIG Nick Translation Mix (1745816) or the Roche Biotin Nick Translation Mix (1745824) for labeling DNA probes.
4
Cytogenetic Analysis of C. hoffmanni
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GTG- and CBG-banding of C. hoffmanni chromosomes were performed according to Seabright67 (link) and Sumner68 (link), respectively. FISH was performed using the cloned satDNA sequences as probes after they were labeled by nick-translation with digoxigenin-11-dUTP (DIG-Nick Translation mix, Roche Applied Science) for SATCHO1 and biotin-16-dUTP (Biotin-Nick Translation mix, Roche Applied Science) for SATCHO2. The probes (~ 150 ng in 50% formamide/2xSSC) were denatured for 10 min at 98 °C. Chromosomes were dehydrated in ethanol series (70%, 90%, 100%) and denatured in 70% formamide/2xSSC for 2 min at 75 °C. The hybridization was performed overnight at 37 °C. Post-hybridization washes comprised two 5 min incubations in 2xSSC at 45 °C. Immunodetection was performed with anti-digoxigenin conjugated with rhodamine (Roche Applied Science) for SATCHO1 and avidin conjugated with FITC (Roche Applied Science) for SATCHO2. Chromosomes were counterstained with DAPI 1:500 in Slowfade (Invitrogen). The analysis was performed under a Zeiss Axioimager 2 epifluorescence microscope adapted with a CCD camera and image acquisition was performed with the AxioVision (Zeiss) software (Carl Zeiss MicroImaging, Jena, Germany).
5
Telomere Repeat FISH Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FISH with rDNA probes was performed as described previously [6 ]. For FISH with a telomere repeat probe, the Arabidopsis type telomere repeat (TTTAGGG)n was generated by PCR according to the protocol described by [25 ]. This probe was labelled with biotin-16-dUTP using the Biotin-Nick Translation Mix (Roche, Switzerland). For the detection of DNA sequences homologous to the telomere repeat, the chromosome slides were pretreated with 1 mg/ml RNase A (Roche, Switzerland) in 2×SSC (1×SSC is 0.15 M NaCl and 0.015 M sodium citrate) at 37°C for 1 h. The hybridization mixture containing 2×SSC, 40% formamide, 10% dextran sulphate and 2 ng/μl of biotinylated telomere DNA probe was used. The probe was hybridized overnight at 37°C. After hybridization the slides were washed twice with 0.1×SSC at 37°C for 10 min, followed by two washes in 2×SSC at 44°C for 5 min and a final wash for 5 min in 2×SSC at room temperature. The hybridization and wash conditions corresponded to 70% DNA homology. The biotin-labelled telomere repeat probe was detected with highly sensitive Tyramide Signal Amplification kit T-20932 (Life Technologies, USA).
6
Detailed Oligo Probe Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two oligo libraries were synthesized by Synbio Technologies (Suzhou, China). The oligo probes were prepared following the previous protocol (Liu et al., 2019 (link)). In brief, through four stages, that is, library amplification with high-fidelity enzyme (KAPA HiFi HotStart ReadyMix, KAPA Biosystems) and T7 in vitro transcription with MEGAshortscriptTM T7 kit (Invitrogen), reverse transcription using biotin- and digoxigenin-labeled RT primers (5′ dye/CGTGGTCGCGTCTCA), and enzymatic RNA removal. Then, the biotin-labeled or digoxigenin-labeled single-stranded oligo probes were directly used as FISH probes. The probe 45S rDNA was isolated using Plasmid Miniprep Kit (Biomiga) according to the handbook and were labeled with Biotin-Nick Translation Mix (Roche) according to the instructions of the manufacturer3 .
7
Visualizing Chromosomal Architecture with FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flower buds were fixed in Farmer’s fixative at 25°C for 12 h. The preparation of nuclei and hybridization of DNA with FISH probes were performed as described previously [43 ]. The DNA probes were synthesized as follows. Probes recognizing the centromeric 180 bp repeats (FP; 5ʹ-GATCAAGTCATATTCGACTC-3ʹ, RP; 5ʹ-GTTGTCATGTGTATGATTGA-3ʹ) was synthesized by nick translation using Biotin Nick Translation Mix (Roche, Basel, Switzerland). Probes recognizing 5S rDNA (FP; 5ʹ-GCGGAGCTCCCCAAATTTTGAC-3ʹ, RP; 5ʹ-GACCACGTGGTCGACAAAAAGTC-3ʹ), 45S rDNA (FP; 5ʹ-CAAGCAAGCCCATTCTCCTC-3ʹ, RP; 5ʹ-CAACTAGACCATGAAAATCC-3ʹ), and telomere repeats (FP; 5ʹ- TAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCC −3ʹ, RP; 5ʹ- GGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTA-3ʹ) were synthesized by nick translation using DIG Nick Translation Mix (Roche). The hybridized nuclei were mounted with VECTASHIELD™ (Vector Laboratories, Burlingame, CA). The nuclei were observed under a light microscope (BX53m, Olympus, Tokyo, Japan) equipped with a CCD camera (DOC CAM U3-50S5M-C, Molecular Devices, Tokyo, Japan). The overlapping of the 180 bp signals and the 45S rDNA signals was analyzed with the ImageJ software. The distances between the position showing the maximum intensity of 5S rDNA signals and that of the nearest 180 bp signals were analyzed with the ImageJ software.
8
Chromosome Preparation and FISH Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosome preparation was performed as described previously (58 (link)). Five individuals of gibel carp clone F were injected phytohemagglutinin (PHA) (15-20 μg/g) in vivo and the head kidney cells were harvested by conventional hypotonic and fixation treatments. Briefly, the cells were exposed to a hypotonic solution for 30 min at room temperature and fixed for 30 min (with replacement of the fixative every 10 min without resuspension) in 3 ml of a 3:1 mixture of methanol and acetic acid. Finally, the cells were resuspended in 0.5 ml of fresh fixative and were spread on clean slides. The slides were prepared by the air-drying technique and storied at -20°C for FISH.
The bacterial artificial chromosome (BAC) clones containing Cgptpn6-A and Cgptpn6-B were screened by PCR. Then, Cgptpn6-A-BAC-DNA and Cgptpn6-B-BAC-DNA labeled by DIG-Nick Translation Mix and Biotin-Nick Translation Mix (Roche) respectively were used to perform FISH as described previously (35 (link), 47 (link)). 4’, 6-diamidino-2-phenylindole (DAPI) was used to counterstain metaphase chromosomes. The results were acquired by Carl Zeiss upright fluorescence microscope Axio imager M2 (Analytical & Testing Center, IHB, CAS).
The bacterial artificial chromosome (BAC) clones containing Cgptpn6-A and Cgptpn6-B were screened by PCR. Then, Cgptpn6-A-BAC-DNA and Cgptpn6-B-BAC-DNA labeled by DIG-Nick Translation Mix and Biotin-Nick Translation Mix (Roche) respectively were used to perform FISH as described previously (35 (link), 47 (link)). 4’, 6-diamidino-2-phenylindole (DAPI) was used to counterstain metaphase chromosomes. The results were acquired by Carl Zeiss upright fluorescence microscope Axio imager M2 (Analytical & Testing Center, IHB, CAS).
9
Multicolor GISH Analysis of Rye-Wheatgrass Hybrids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomes were prepared from mitotic metaphase following the protocol described by Chen et al. (2005) (link). GISH was performed using techniques described by Zhao et al. (2013) (link). Total genomic DNA of Imperial rye and Th. elongatum were labeled with DIG-Nick Translation Mix and Biotin-Nick Translation Mix (Roche, Germany), respectively, for use as probes for multicolor GISH. Hybridization signals were observed using a Zeiss Axioplan 2 fluorescence microscope, and images of signal patterns were acquired with a charge-couple device camera (Zeiss, Germany).
10
Fluorescent Mapping of Ribosomal and Telomeric DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5S and 18S ribosomal DNA probes were obtained from the genomic DNA of A. falcirostris PCR ), using the primers 18Sf (50-CCG CTG TGG TGA CTC TTG AT-30), and 18Sr (50 - 31 CCG AGGACC TCA CTA AAC CA- 30) (Gross et al. 2010 (link)), 5Sa (50-TAC GCC CGA TCT CGT CCG ATC-3’) and 5Sb (5’- CAGGCT GGT ATC GCC GTA AGC-3’) (Martins and Galetti 1999 (link)). Telomeric segments were generated using non-templated PCR with primers (TTAGGG)5 and (CCCTAA)5 (Ijdo et al. 1991 (link)).
ThePCR products were verified in 1.5% agarose gel, and quantified in NanoVue Plus (GE Healthcare). The 18S rDNA gene was marked with digoxigenin-11-dUTP (Dig Nick Translation mix, Roche), while the 5S rDNA gene and telomeric sequences were marked with biotin-14-dATP (Biotin Nick Translation mix, Roche), following the manufacturer´s instructions. The hybridization signals were detected using anti digoxigenin-rhodamine (Roche Applied Science) for the 18S rDNA probe, and streptavidin (Sigma-Aldrich) for the 5S rDNA probes and telomeric sequences. Fluorescence in situ hybridization (FISH ) was based on the protocol of Pinkel et al. (1986) (link), with a stringency of 77%. The chromosomes were counter-stained with (2 mg/mL) DAPI in a Vectashield (Vector) mounting medium.
The
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!