Quikchange site directed mutagenesis protocol

For randomized codon-based saturation mutagenesis the “QuikChange” Site-Directed Mutagenesis protocol (Agilent/Stratagene; La Jolla, CA, USA) was applied, with minor adaptations, using the pRSET A::Zm-p60.r construct as a template. Plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, USA). A library of Zm-p60.1 mutants with variations at the Trp373 position was created using the following set of primers introducing NNM degeneracy:
Mutant strands were synthesized using a 2400 GeneAmp PCR system (PerkinElmer; Waltham, MA, USA), with 60 cycles of denaturation at 95°C for 2 min, annealing at 55°C for 20 s and extension at 65°C for 2 min 18 s. Dpn I restriction was then applied to avoid amplification of the template. Competent E. coli cells were transformed, the transformants were grown and selected. The number of colonies was low due to the low transformation efficiency of the engineered E. coli strain. Finally, to complete the library we created missing variants using the QuikChange kit again in individual reactions with the same template and following primers –
Due to expression problems with Leu and Ser variants their codons were changed to TCC for Ser and CTG for Leu. W373K was obtained previously [7] (link). All variants were finally confirmed by sequencing (SEQme, Czech Republic).

pYesDEST52-LHR1-HA was constructed as described elsewhere [25 (link)]. Site-directed mutagenesis was performed on pYesDEST52-LHR1-HA using the QuikChange Site-Directed Mutagenesis protocol (Agilent Technologies; Cat. # 200518); Table 1 below describes the primers used.
To generate yeast expression plasmids for the glycerol/lactate spot growth assay, pYesDEST52-yLHR1-HA WT, Y18A, H36A, Y80A or Y129A plasmids were amplified by PCR using gene specific primers (5-BglII-yLHR1: 5ʹ-GACCGCGAGATCTAAAAAAATGAACGAATT AGAAAGAAAG-3ʹ, 3-XhoI-yHA: 5ʹ-GGACTGACATCTCGAGTTAAGCATAATCA GGAACATCGTATGGGTA-3ʹ), digested with BglII and XhoI, and ligated into Yep352/PGK91-2 vector (Gift from Dr. Caroline C. Philpott).
To generate yeast expression plasmids for the Gallium (III) Protoporphyrin IX (GaPPIX) spot growth assay, the yeast codon-optimized LHR1 (pYesDEST52-yLHR1) that was previously described [25 (link)] was tagged at the c-terminus with the HA epitope using primers 5ʹ-CGTCGTATGGGTAACCTGCACAGTTTT CCTTTG-3ʹ and 5ʹ-TCCCAGACTACGCTTAATCTAGAGGGCCCTTC-3ʹ to generate pYesDEST52-yLHR1-HA. pYesDEST52-yLHR1-HA was then used to generate the mutants using the QuikChange Site-Directed Mutagenesis protocol; Table 2 below describes the primers used.

cDNA of the wild type (WT) 1-FFT from Ht (accession no. AJ009756, van der Meer et al., 1998 (link)) and Vd (accession no. AJ811625, Van den Ende et al., 2005a (link)) was introduced in the Pichia pastoris expression vector pPICZαA. The expression vector containing the Vd WT 1-FFT cDNA was used as template to introduce a Met to Phe mutation in the KNMIY (M19F) and a His to Thr mutation in the WAHVY (H308T) region of this enzyme (Figure 1). Mutations were introduced through the QuikChange site-directed mutagenesis protocol (Agilent Technologies) with the following oligonucleotide primers (and their reverse complements): M19F: CAGCCTGCGAAGAATTTTATTTACGATCCAGATG and H308T: CTAGAGGATGGGCTACTGTTTATAATGTTG. After site-directed mutagenesis, the methylated template strand was digested by 1 μl of DpnI (37°C for 2 h) and purified by E.Z.N.A. Cycle Pure Kit (Omega bio-tek). Subsequently, 4 μl of the purified DNA was used to transform 40 μl of E. coli TOP10 cells through heat shock. Selection of positive colonies was done on low salt YT-zeocin (30 μg/ml) agar plates. The FastPlasmid Mini Kit (5Prime) was used to obtain and purify the plasmids from the positive colonies, after which sequencing (Macrogen, The Netherlands) was done to confirm the introduction of the desired mutations.

We used the QuikChange site-directed mutagenesis protocol (Agilent Technologies) to mutate individual TF-binding motifs in the RepBase-consensus sequence. We designed primers to target each motif on plasmid constructs and incorporate upto four mutations per motif (Supplementary Tables 6B and 11).
Mutations were introduced at positions in the motif that had the highest information content and were replaced by the least informative nucleotide at that position. We verified the primers to ensure that the mutations did not create a new TF-binding motif, using the TOMTOM tool from the MEME suite of motif analysis67 (link).

An overexpression system was developed to supply recombinant ChiX and the variant ChiX D120A protein. The chiX gene was amplified by PCR from S. marcescens DB10 genomic DNA to produce a fragment with engineered BamHI/NotI restriction sites, which were subsequently used to clone chiX into a pGEX-6P-1 vector (GE Healthcare) that would encode a fusion to glutathione S-transferase (GST). For expression of the native gene, a pBAD18 [13 (link)] construct was produced, with the chiX gene amplified by PCR to produce a fragment with engineered XbaI/SphI restriction sites before cloning into a pBAD18 vector. The D120A substitution was introduced into the pBAD18 chiX and pGEX6p1 chiX plasmids using the QuikChange Site-Directed Mutagenesis Protocol (Agilent).