Dtdt overhanging 19 nt rna duplexes

Manufactured by Thermo Fisher Scientific

The DTdT-overhanging 19 nt RNA duplexes are short, double-stranded RNA molecules with 19 nucleotide sequences and 2-nucleotide overhangs at the 3' ends. These duplexes are designed for various applications in molecular biology and cell biology research.

Automatically generated - may contain errors

Lab products found in correlation

Ck 869, by Merck Group (2 mentions) Flexitube genesolution 4 sirna sets, by Qiagen (2 mentions) Mission plko1 shrna, by Merck Group (2 mentions) Smifh2, by Merck Group (2 mentions) Latrunculin a, by Merck Group (2 mentions)

Spelling variants of this product

RNA duplexes (3 citations)

2 protocols using dtdt overhanging 19 nt rna duplexes

Efficient Inhibition and Knockdown Strategies

Check if the same lab product or an alternative is used in the 5 most similar protocols

The small-molecule inhibitors were SMIFH2 (Sigma s4826, 60 microM), CK-869 (Sigma C9124, 80 microM) LatrunculinA (Sigma L5163, 0.5 microM), G2 (Xcessbio M60269 for cell treatments, Valuetech custom synthesis for mouse injections). All plasmids were sequence-verified before use and transfected as endotoxin-free maxi preps. siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo). shRNAs were selected among pre-validated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector^{25 (link)}. Sequences of siRNAs are provided in Table 1.Table 1

siRNA and shRNA sequences.

Target gene	siRNA or shRNA Sequence
hFSCN1 A	UGGCAAGUUUGUGACCUCC
hFSCN1 B	CAGCGUCACCCGUAAGCGC
hCAPZB A	GAAGUACGCUGAACGAGAUck
hCAPZB B	GGAGUGAUCCUCAUAAAGA
AllStars negative control (Qiagen)	Not available—proprietary information
Scramble control shRNA	UUCUCCGAACGUGUCACGU
mFSCN1 A	CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGC TACTAGCGGATGCTTTTTG
mFSCN1 B	CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAG GATAACAGGAGGTTTTTG

Pocaterra A., Scattolin G., Romani P., Ament C., Ribback S., Chen X., Evert M., Calvisi D.F, & Dupont S. (2021). Fascin1 empowers YAP mechanotransduction and promotes cholangiocarcinoma development. Communications Biology, 4, 763.

+ Open protocol

+ Expand

Evaluation of Small-Molecule Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The small-molecule inhibitors were SMIFH2 (Sigma s4826, 60 microM), CK-869 (Sigma c9124, 80 microM) LatrunculinA (Sigma L5163, 0.5 microM), G2 (Xcessbio M60269 for cell treatments, Valuetech custom synthesis for mouse injections). All plasmids were sequenceverified before use and transfected as endotoxin-free maxi preps. siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo). shRNAs were selected among prevalidated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector (24)

Pocaterra A., Ament C., Ribback S., Chen X., Evert M., Calvisi D.F., & Dupont S. (2020). Fascin1 empowers YAP mechanotransduction and promotes cholangiocarcinoma development.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!