Pgfp c scr shlenti

The Ku86-specific shRNA lentiviral construct pGFP-C-Ku86-shRNALenti (TL502435) and non-effective 29-mer scrambled shRNA lentiviral construct pGFP-C-scr-shLenti (TR30021) were obtained from Origene Technologies. To generate the lentivirus, pGFP-C-shLenti vector and packaging vectors were used to cotransfect HEK293T cells according to the manufacturer's instructions (Lenti-vpak Lentiviral Packaging Kit, Origene). Viral supernatants were collected and used to transduce Rad52^+/+ and Rad52^−/− B cells. Transduced B cells were then stimulated with LPS plus IL-4 for 96 h before analysing GFP⁺ and IgG1⁺ B cells by flow cytometry—dead (7-AAD⁺) cells were excluded from analysis. Expressions of Rad52, Ku86 and β-Actin proteins in the transduced B cells were analysed by immunoblotting.

The human LIX1‐specific short hairpin RNA (shRNA) constructs pGFP‐C‐LIX1‐shRNALenti (TL303518A for shLIX1#1: 5′‐AGTGTTCAGGAAGCAGTAGCCTCCACCAG‐3′ and TL303518B for shLIX1#2: 5′‐AGCCAGGAAAAGCAGGACAAGAACTACGGT‐3′) were obtained from Origene Technologies. The 29‐mer Scrambled shRNA construct pGFP‐C‐Scr‐shLenti (TR30021 for Scramble: 5′‐GCACTACCAGAGC‐TAACTCAGATAGTACT‐3′) from Origene Technologies was used as control. SMARTpool ON‐TARGETplus human YAP1 siRNA (L‐016083‐00‐0010) and ON‐TARGETplus WWTR1 siRNA (L‐016083‐00‐0010) were from DHARMACON‐GE.