Cells were fixed in 4% paraformaldehyde for 30 min and then were incubated at 37°C for 2–3 h in blocking buffer (PBS containing 5% BSA and 0.2% Triton X-100). After washing three times with PBS, the cells were incubated with the primary antibody overnight at 4°C. After being washed three times with PBS, then the cells were incubated with the fluorescent secondary antibody and Hoechst 33342 (H3570, Invitrogen, 1:10000) for 1 h at 37°C in the darkroom. The cells were photographed under a Leica DMI8 microscope. The antibodies used are Sox2 (66411-1-Ig, Proteintech,1:500) and Tfap2c (sc-12762, Santa Cruz, 1:100).
Tfap2c
Manufactured by Santa Cruz Biotechnology
Sourced in United States
TFAP2C is a transcription factor that regulates the expression of genes involved in development and differentiation. It plays a role in the regulation of cell growth and survival. TFAP2C is commonly used in research applications to study gene expression and cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Dmi8 microscope, by Leica (2 mentions)
Mmp14, by Abcam (2 mentions)
Foxa2, by Cell Signaling Technology (2 mentions)
C casp3, by Cell Signaling Technology (2 mentions)
Mab1948p, by R&D Systems (2 mentions)
Mab1986, by Cell Signaling Technology (2 mentions)
T brachyury, by R&D Systems (2 mentions)
E cadherin, by Thermo Fisher Scientific (2 mentions)
Laminin, by Merck Group (2 mentions)
Sox2 66411 1 ig, by Proteintech (1 mentions)
Prdm14, by Abcam (1 mentions)
Nanos3, by Abcam (1 mentions)
Ssea4, by Abcam (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Alexa fluor 488 conjugated donkey anti rabbit igg, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 594 conjugated donkey anti mouse igg, by Thermo Fisher Scientific (1 mentions)
Phosphate buffered saline (pbs), by Jackson ImmunoResearch (1 mentions)
Hla g, by Santa Cruz Biotechnology (1 mentions)
Am1829b, by Abcepta (1 mentions)
11 protocols using tfap2c
1
Immunofluorescence Staining of Sox2 and Tfap2c
2
Immunofluorescence Staining of Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were fixed in 4% paraformaldehyde/PBS for 15 min at room temperature and permeabilized with 1% Triton X-100/PBS (Sigma) for 10 min. After blocking with 10% donkey serum in PBS (Jackson ImmunoResearch) for 1 h at room temperature, cells were incubated with primary antibodies overnight at 4 °C, followed by incubation with appropriate fluorescent-conjugated secondary antibodies for 1 h at room temperature the next day. Primary antibodies were as follows: OCT4 (Abcam), SOX2 (Abcam), SSEA4 (Abcam), TFAP2C (Santa Cruz), PRDM14 (Abcam), and NANOS3 (Abcam). Secondary antibodies were as follows: AlexaFluor 488 conjugated donkey anti-rabbit IgG and AlexaFluor 594 conjugated donkey anti-mouse IgG (all Life Technologies). The nuclei were counterstained with DAPI (Thermo Fisher Scientific). The cells were observed with a Zeiss inverted confocal microscope.
3
Western Blot Analysis of Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed using Laemmli Sample Buffer (Bio-Rad, 1610747) supplemented with 5% β-mercaptoethanol (MilliporeSigma, M3148). Lysates were heated to 95 °C for 10 min then loaded on 7.5%, 10%, or 12% SDS gel, depending on the size of target proteins, followed by transfer to PVDF membranes (MilliporeSigma, IPVH00010). Membranes were blocked in 5% skim milk (Bio-Rad, 1706404) or 5% BSA (Sigma-Aldrich, A7906) in TBS-T (Tris-buffered saline with 0.1% Tween 20), and incubated with primary antibody overnight at 4 °C, followed by washing three times in TBS-T. The membranes were incubated in secondary antibodies for 1 h at room temperature, followed by washing three times in TBS-T. Membranes were incubated with ECL Western blotting detection reagent (Fisher Scientific, 45-002-401) and imaged using ChemiDoc XRS+ (Bio-Rad). The following primary antibodies were used for Western blot: DLX5 (Novus Biologicals, NBP1-85793, 0.2 mg/mL), DLX6 (abcam, ab137079, 1:2,500), ASCL2 (R and D Systems, AF653, 1 ug/mL), ZNF439 (GeneTex, GTX119735, 1:1,000), NRIP1 (Millipore, MABS1917, 1:1,000), TFAP2C (Santa Cruz Biotechnology, sc-12762, 1:500), HLA-G (Santa Cruz Biotechnology, sc-21799, 1:500), MMP2 (Cell Signaling Technology, 40994, 1:1,000), and ACTB (Abgent, AM1829B, 1:20,000).
4
Molecular Markers for Developmental Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E-cadherin (1:300; Thermofisher Scientific, 13-1900), Oct4 (1:400; Santa Cruz Biotechnologies, sc-5279), Tfap2c (1:200; Santa Cruz, Santa Cruz Biotechnologies sc-8977)Laminin (1:400; Sigma, L9393), Collagen IV (1:100; Millipore, AB769), HSPG2 (1:100; Millipore, MAB1948P), Otx2 (1:100; R&D Systems, AF1979), Cerberus (1:500; R&D Systems, MAB1986), Foxa2 (1:200; Cell Signalling Technologies, D56D6), T/Brachyury (R&D Systems, MAB1556), c-Casp3 (1:200; Cell Signalling Technologies, 9664S), MMP14 (1:150; Abcam, ab51074).
5
Proximity Ligation Assay for Arid4b and Tfap2c
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PLA is performed using Duolink In Situ Red Starter Kit (Sigma-Aldrich, DUO92101) using Arid4b (rabbit, 1:500, ls-c199776; LifeSpan BioSciences, Seattle, WA, USA) and Tfap2c (mouse, 1:100, sc12762; Santa Cruz Biotechnology, Dallas, TX, USA) primary antibodies on wild-type (CJ9) mESCs according to the manufacturer’s protocol. Confocal microscopy (Leica TCS SP8, Leica Microsystems, Wetzlar, Germany) imaging was performed at Bilkent University UNAM Laboratories (Ankara, Turkey).
6
Chromatin Immunoprecipitation of Epigenetic Marks
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using Pierce™ Magnetic ChIP Kit (Thermo Fisher) according to the manufacturer's protocol. Briefly, 6 × 106 cells were cross‐linked using 1% formaldehyde for 10 min, lysed, and digested with micrococcal nuclease. ChIP was performed using 2.5 μg antibodies of H3K9me3 (ab8898; Abcam), H3K4me3 (C15410003‐50; Diagenode, Denville, NJ, USA), TFAP2C (sc‐12762x ; Santa Cruz), PELP1 (A300‐180A; Bethyl), or 2.5 μg of isotype control IgG antibody. ChIP DNA was resuspended in 50μL TE buffer and used for RT–qPCR amplification using the gene‐specific primers: RET −101.5 kb forward: 5′‐TACTGTCAAGCCACGTCAGC‐3′, reverse: 5′‐CGCTACCTCTAACAGGCGAA‐3′. RET −50.7 kb forward: 5′‐ACGCATTGTTCACCCACTGA‐3', reverse: 5'‐AAGGTTAGAAGCTGCGCTGT‐3′. RET −32.5 kb forward: 5′‐ACTAGCTCCTCACCTACCCG‐3′, reverse: 5′‐CTCTCCTATGCAGGCTGCTC‐3′. RET +5.0 kb forward: 5′‐AAGGACAGCAGTTCAGGTCG‐3′, reverse: 5′‐CACTTTGTGGAGCCACTCCT‐3′. RET −46.8 kb forward: 5′‐AGGGATGGACCAGTCCAAGT‐3′, reverse: 5′‐TCAGAGCCCAAGATGGAGGA‐3′. GAPDH promoter forward: 5′‐CCGGGTCTTTGCAGTCGTAT‐3', reverse: 5'‐GGGAGTAGGGACCTCCTGTT‐3′. For Re‐Chip assay, the first ChIP was performed using TFAP2C antibody, DNA was eluted using 15 mm DTT in TE buffer and was used for secondary ChIP assay with PELP1 or IgG antibody.
7
Molecular Markers for Developmental Characterization
8
GDNF-Induced Signaling Pathway Analysis
9
Immunofluorescence Analysis of Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with PBS three times and then fixed with 4% paraformaldehyde for 20 min at room temperature. After incubation in blocking buffer (PBS containing 5% BSA and 0.2% Triton X-100) for 2 h, the cells were placed in the diluent of primary antibody at 4 °C overnight. The antibodies were Klf4 (1:500, R381633, ZENBIO) and Tfap2c (sc12762, 1:100, Santa Cruz). After three washes with PBS, the cells were then incubated with a fluorescent secondary antibody and Hoechst 33342 (H3570, Invitrogen, 1:10,000) for 1 h at 37 °C in the dark. The cells were photographed under a Leica DMI8 microscope.
10
Western Blot Analysis of Protein Markers
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!