Primer premier software version 5

Using Primer Premier software version 5 (Applied Biosystems, Austin, TX, USA), we designed multiple primer and probe sets targeting the RdRp, N, and Spike (S) gene regions of the SARS-CoV-2 genome (hCoV-19/Wuhan/IVDC-HB-04/2020, Accession ID: EPI_ISL_402120, B lineage; hCoV-19/South Africa/KRISP-K007869/2020, Accession ID: EPI_ISL_860630, B.1.351 lineage; hCoV-19/England/MILK-9E05B3/2020, Accession ID: EPI_ISL_601443, B.1.1.7 lineage; hCoV-19/Brazil/SP-1869/2021, Accession ID: EPI_ISL_1293069, B.1.1.28 lineage; hCoV-19/USA/CA-CZB-14228/2020, Accession ID: EPI_ISL_738815, B.1.429 lineage; hCoV-19/Finland/FinD796H/2021, Accession ID: EPI_ISL_1061414, B.1.1.318 lineage). Hydrolysis probes were labeled at the 5′ end with 6-carboxyfluorescein (6-FAM) and with black hole quencher 1 at the 3′ end [Table 1]. The S484K and S501Y rRT-PCR assays targeting S gene of SARS-CoV-2 variants, the primers and probes were (forward: 5′- CTGAAATCTATCAGGCCGGTAG -3′; reverse: 5′-CTACTCTGTATGGTTGGTAACC-3′; probe: 5′-FAM-TAATGGTGTTAAAGGTT-MGB-3′) and (forward:5′- GTTACTTTCCTTTACAATCATATG-3′; reverse: 5′- TTTAGGTCCACAAACAGTTGC-3′; probe: 5′-FAM- AACCCACTTATGGTG-MGB-3′), respectively.

Multiple primer and probe sets were designed based on bioinformatics analysis of three complete genomes of SARS-CoV-2 (BetaCoV/Wuhan/IVDC-HB-01/2019, Accession ID: EPI_ISL_402119, BetaCoV/Wuhan/IVDC-HB-04/2020, Accession ID: EPI_ISL_402120) obtained in our lab (5 ,8 (link)). ORF1ab, E gene and N gene sequences were selected as targets using Primer Premier software version 5 (Applied Biosystems) with the following default settings: primer melting temperature (TM) set at 60 °C; probe TM set at 10 °C greater than the primers at approximately 70 °C; and no guanidine residues permitted at the 5’ probe termini (Figure 1A, Table 1). Previous reported prime and probe sets for the RNA-dependent RNA polymerase (RdRp) region of pan beta-CoV was designed as a reference experiment (3 (link),9 (link)).