We removed cas9/GFP from PX461 (Addgene #48140) (Ran et al., 2013 (link)) and replaced with GFP/Zeocin from pTRACER-EF/V5-His A (Life Technologies). GFP/Zeocin expression was controlled by the CMV promoter on PX461.s gRNA GGCGCGGGAAGCCTATAACC (PAM AGG) to target PRPF6 c.2185C > T p.Arg729Trp was cloned into the BbsI sites, for expression from the U6 promoter. This was co-transfected with pCMV-BE3 (Addgene #73021) (Komor et al., 2016 (link)) which contains the BE3 gene (Base Editor; cytidine deaminase) under the control of a CMV promoter, into HEK293 cells using PEI. Cells were selected with zeocin.
Pcmv be3
Manufactured by Addgene
Sourced in United States
PCMV-BE3 is a plasmid that contains a gene encoding a Cas9 enzyme. The Cas9 enzyme is a key component of the CRISPR-Cas9 gene editing system, which is used for targeted genome modifications.
Automatically generated - may contain errors
Lab products found in correlation
Pcmv abe7, by Addgene (3 mentions)
Be4 gam, by Addgene (2 mentions)
Lentiguide puro, by Addgene (2 mentions)
Megaclear transcription clean up kit, by Thermo Fisher Scientific (2 mentions)
Pcmv abemax, by Addgene (2 mentions)
Pcmv ancbe4max, by Addgene (2 mentions)
Megashortscript t7 transcription kit, by Thermo Fisher Scientific (2 mentions)
Px330 mcherry, by Addgene (1 mentions)
Mmachine t7 ultra transcription kit, by Thermo Fisher Scientific (1 mentions)
Pcmv ha3a be3 y130f, by Addgene (1 mentions)
Megashortscript t7 kit, by Thermo Fisher Scientific (1 mentions)
Universal dna purification kit, by Tiangen Biotech (1 mentions)
Hifi dna assembly kit, by New England Biolabs (1 mentions)
Phusion polymerase, by Thermo Fisher Scientific (1 mentions)
T4 ligase, by New England Biolabs (1 mentions)
Midi prep kit, by Macherey-Nagel (1 mentions)
Nebuilder hifi dna assembly master mix, by New England Biolabs (1 mentions)
Pgl3 u6 sgrna pgk puromycin, by Addgene (1 mentions)
Px458, by Addgene (1 mentions)
Px458, by Sangon (1 mentions)
12 protocols using pcmv be3
1
Base Editor-Mediated PRPF6 Modification
2
Synthesizing mRNA and sgRNA for Gene Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA transcriptional templates of different base editors and Cre were amplified by PCR using KOD-Plus-Neo (TOYOBO) from plasmids pCMV-BE3 (Addgene#73021), BE4-Gam (Addgene#100806), pCMV-hA3A-BE3-Y130F (Addgene#113428), pCMV-hA3A-eBE3-Y130F (Addgene#113423), xCas9(3.7)-BE3 (Addgene#108380), xCas9(3.7)-BE4 (Addgene#108381) and pZ4f-Cre, purified by the Universal DNA Purification Kit (TIANGEN, Cat#DP214) and then transcribed using the mMACHINE T7 ULTRA Transcription Kit (Invitrogen, Cat#AM1345) following the manufacturer’s instruction. The transcriptional templates of sgRNAs were amplified from pX330-mCherry (Addgene#98750) and transcribed in vitro using the MEGAshortscript T7 kit (Invitrogen, Cat#AM1354) following the manufacturer’s instruction. mRNAs and sgRNAs were subsequently purified with the MEGAclear Transcription Clean-Up Kit (Invitrogen, Cat# AM1908), resuspended in hot (95 °C) RNase-free water and then stored at −80 °C.
3
CRISPR Plasmid Construction and Acquisition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the gRNA sequences listed (Table S1 ) were synthesized by GENEWIZ Biotechnology, Ltd. (Suzhou, China) and then inserted into the pBluescriptSKII+ U6-sgRNA(F+E) empty plasmid (Addgene #74707) through a BbsI site. pCMV-BE3, pCMV-ABE7.10, pCMV_AncBE4max and pCMV_ABEmax were obtained from Addgene (Plasmid #73021, #102919, #112094 and #112095). NG-AncBE4max, NG-ABEmax, xCas9-AncBE4max and xCas9-ABEmax were kept in this lab.
pJH372, pJH373, pJH375, and pJH376 (mammalian expression of AcrIIA1, AcrIIA2, AcrIIA3, and AcrIIA4) were obtained from Addgene (Plasmid #86839, #86840, #86841, and #86842). pCMV-T7-hAcrVA1-NLS (sv40) (BPK5050), pCMV-T7-hAcrVA2.1-NLS (sv40) (BPK5059), pCMV-T7-hAcrVA2-NLS (sv40) (AAS2283), pCMV-T7-hAcrVA3.1-NLS (sv40) (RTW2624), and pCMV-T7-hAcrVA3-NLS (sv40) (BPK5077) were obtained from Addgene (Plasmid #115136, #115137, #115138, #115139, and #115140). Human codon-optimized AcrIIA5, AcrIIC1, AcrIIC2, and AcrIIC3 [28 (link)] anti-CRISPR sequences (Table S4 ) were synthesized by GenScriptBiotechnology, Ltd. and then inserted into pcDNA3.1(+) expression vectors through BamHI/EcoRI sites.
pJH372, pJH373, pJH375, and pJH376 (mammalian expression of AcrIIA1, AcrIIA2, AcrIIA3, and AcrIIA4) were obtained from Addgene (Plasmid #86839, #86840, #86841, and #86842). pCMV-T7-hAcrVA1-NLS (sv40) (BPK5050), pCMV-T7-hAcrVA2.1-NLS (sv40) (BPK5059), pCMV-T7-hAcrVA2-NLS (sv40) (AAS2283), pCMV-T7-hAcrVA3.1-NLS (sv40) (RTW2624), and pCMV-T7-hAcrVA3-NLS (sv40) (BPK5077) were obtained from Addgene (Plasmid #115136, #115137, #115138, #115139, and #115140). Human codon-optimized AcrIIA5, AcrIIC1, AcrIIC2, and AcrIIC3 [28 (link)] anti-CRISPR sequences (
4
Rapid CRISPR Vector Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthesized oligos were used for each of the target sgRNAs. The oligos were extended using Phusion polymerase (Thermo Fisher Scientific) and then ligated with the pRG2-GG vector (Addgene 104174) using T4 ligase (NEB). The cloned vector was transformed into competent DH5a cells (Invitrogen). The plasmids were extracted using a Midi Prep Kit (MACHEREY-NAGEL), and the sequences were confirmed by Sanger sequencing analysis (Bionics). Next, pCMV-BE3 (Addgene 73021), pCMV-AncBE4max (Addgene 112094), pCMV-ABE7.10 (Addgene 102919), and pCMV-ABEmax (Addgene 112095) were obtained from Addgene. The newly designed vectors containing dCas9 or CMPs or TadAmax of ABE8e were structured using the HiFi DNA Assembly Kit (NEB). The target sequences are listed in Supplementary Table 1 .
5
Generation of Customizable Genome-Editing Tools
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pCMV-BE3 (Addgene plasmid#73021) and pCMV-YE1-FNLS-BE3 (Addgene Plasmid #154005) were used as backbones. A CMV-mCherry expression cassette was inserted into backbone plasmid and the sequence encoding UGI was replaced by codon optimized UNG sequence (Genewiz). Site-directed mutagenesis was performed using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) for constructing plasmids expressing different CGBEs. U6-sgRNA-scaffold-pCMV-EGFP-poly A was generated through NEBuilder HiFi DNA Assembly, by combining a PCR-amplified U6-sgRNA-scaffold with a digested pCMV-EGFP-poly A backbone. The amino-acid sequence for OPTI-CGBEs was supplied in Supplementary Data 1 .
6
CRISPR-Cas9 Plasmid Construction for Targeted Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids encoding BE3 (pCMV-BE3) were obtained from Addgene (73021). The small-guide RNA (sgRNA) (the guide RNA of CRISPR-Cas9 protein) for rs75356281 base editing was designed with an online sgRNA design tool, CHOPCHOP (87 ), and synthesized by Tsingke Biological Technology. Then the DNA oligos were annealed and cloned into the BsaI site of the sgRNA-expressing vector, pGL3-U6-sgRNA-PGK-puromycin (51133, Addgene). The sequence of the sgRNA used in this study is 5′-TATGGTCATAGGCCCACAGGTGG -3′ (the underlined sites are the short protospacer adjacent motif flanking the target DNA site).
7
Porcine IGF2 CRISPR Editing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide sequence for sgRNA targeting the ZBED6 binding motif in intron 3 of porcine IGF2 were designed using the open-source tool, CHOPCHOP (http://chopchop.cbu.uib.no/ ). The BE3 (a fusion protein of deaminase Apobec-1, Cas9 (D10A) nickase, and Uracil Glycosylase Inhibitor (UGI)) coding sequence was digested from the pCMV-BE3 (Addgene #73021, Cambridge, MA, USA), and cloned into the pX458 (Addgene #48138, Cambridge, MA, USA) to replace the 3 × FLAG-Cas9 coding sequence to generate the pX458-BE3 plasmid, which contains the enhanced green fluorescent protein (EGFP) reporter. Oligos of gRNA targeting porcine IGF2-intron3-3071 were synthesized (Sangon Biotech, Shanghai, China) and cloned into the plasmid pX458-BE3 through Bbs I restriction site to create the plasmid pX458-BE3-gRNA.
8
Lentiviral Genome Editing Using spCas9 and BE3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
spCas9 in lentiCas9-Blast (Addgene plasmid #52962) and BE3 in pCMV-BE3 (Addgene plasmid #73021) were used for genome editing. To construct the lentiBE3-Blast plasmid DNA for lentivirus production, the BE3 coding regions were amplified by PCR and cloned into the lentiCas9-Blast vector using XbaI (NEB #R0145) and BamHI (NEB #R3136) restriction enzymes. The gRNA constructs were cloned into lentiGuide-puro (Addgene plasmid #52963), and the target sequences of each gRNA are listed in Supplementary Table 2 .
9
CRISPR-Based Gene Editing Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pCMV-BE3 (Addgene plasmid #73021), pBK-VQR-BE3 (Addgene plasmid #85171), and pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA (Addgene plasmid #79620) were obtained from Addgene. pCMV-BE3 and pBK-VQR-BE3 were gifts from David Liu. pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA (HPRT) (Addgene plasmid #79620) was a gift from Akihiko Kondo. The mRNA template for BE, VQR-BE, and Target-AID were prepared by PCR using Herculase II Fusion DNA Polymerase (Agilent Technologies, #600675) with primers as listed in Supplementary Table 4 . BE, VQR-BE, and Target-AID mRNAs were synthesized using the mMESSAGE mMACHINE T7 Ultra Transcription Kit (Thermo Fisher Scientific, AM1345). Templates for in vitro transcription of sgRNAs against each of the Psen1 mutations and the App gene were prepared by PCR using Herculase II Fusion DNA Polymerase with primers as listed in Supplementary Table 5 . The sgRNAs were synthesized using the MEGAshortscript T7 Transcription Kit (Thermo Fisher Scientific, AM1354). Transcribed mRNAs and sgRNAs were purified using the MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific, AM1908).
10
Engineered Transcriptional Regulators for CRISPR Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pCMV-BE3 (Addgene plasmid # 73021) was a gift from David Liu. Genes expressing LaG-2, LaG-2/G4, LaG-2/G4.1, LaG-2/G4.2, LaG-2/G4.3, AIDmut1, AIDmut2, and membrane-expressed LaG-2 (mLaG-2) were directly synthesized (GenScript, Nanjing, China) and subcloned into pCDH-CMV-MCS-EF-1α-Puro. Genes expressing 3×gRNA, 3×gRNAΔ, 3×gRNAΔ15, and 3×gRNAΔ21 were directly synthesized (GenScript, Nanjing, China) and subcloned into pLL7-U6-MCS-EF-1α-Blast. The full sequences of these genes or plasmids were provided in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!