Firepol taq dna polymerase

Genomic DNA was extracted as indicated by Cardinali et al.43 . ITS1, 5.8S, ITS2 rDNA genes were amplified with FIREPol^® Taq DNA Polymerase (Solis BioDyne, Estonia), using ITS1 (5′-TCCGTAGGTGAACCTGCGG) - ITS4 (TCCTCCGCTTATTGATATGC) primers.
The amplification protocol was carried out as follows. Initial denaturation at 95 °C for 4 min, 35 amplification cycles (94 °C for 1 min, 53 °C for 1 min and 72 °C for 1 min) and final extension at 72 °C for 10 min. Amplicons were purified with the GFX PCR DNA purification kit (GE Healthcare) and subject to electrophoresis on 1.5% agarose gel (Gellyphor, EuroClone, Italy). Amplicons were sequenced in both directions with ABI PRISM technology by MACROGEN (www.macrogen.com) with the same primers used for the generation of the amplicons. Consensus sequences for each strain and trimming of the ends with low sequencing quality were carried out with Geneious R6 (v. 6.17, Biomatters, Auckland, New Zealand, www.geneious.com). ITS-based species identification was carried out with BLAST search44 (link) in GenBank (www.ncbi.nlm.nih.gov/genbank/) and refined with specialized databases, RefSeq45 (link) and ISHAM-ITS reference database (ref. 46 (link)).

Contigs that were related to a unique lowest common ancestor (LCA) according to MEGAN software were aligned and scaffolded. Gaps in the Tb1 genome were filled by sequencing PCR amplicons: five primer pairs were designed using the contig sequence as a template and the Primer3 Plus online tool (https://www.primer3plus.com/amplification; Table S1).
PCRs were performed using a reaction mixture containing 1× PCR buffer, 2.5 mM MgCl₂, 0.2 mM dNTPs, 0.8 mM of each primer, and 2.5 U FirePol Taq DNA Polymerase (Solis Biodyne, Tartu, Estonia), with a cycling program of 5 minutes at 95°C, followed by 40 cycles of 30 seconds at 95°C, 30 seconds at 55°C, and 30 seconds at 72°C, with a final extension at 72°C for 5 minutes. PCR amplicons were checked by size determination under UV light after electrophoresis in a 2% agarose gel and ethidium bromide staining. Subsequently, PCR amplicons were purified with spin columns (Nucleospin Gel and PCR Clean-up, Macherey-Nagel) and sequenced using Sanger at a sequencing facility (Joint Laboratory of Aquatic Biotechnology, Faculty of Biochemical and Pharmaceutical Sciences, Argentina).
Coverage statistics of the novel genomes were estimated by remapping the trimmed read data sets to the sequences using Bowtie2 v2.2.6 (22 (link)) and by visual inspection with Ugene (v40.0, Unipro) (23 (link)).

DNA samples were genotyped at nine standard species-specific microsatellite markers (MarMa2671, MarMa3050, MarMa3621, MarMa4143, MarMa4322, MarMa4726, MarMa5167, MarMa5280 and MarMa5023) as described by Geist et al.^{15 (link)} and Geist & Kuehn^{16 (link),17 (link)}. Polymerase chain reactions (PCRs) were performed in a total volume of 12.5 µL containing 25 ng genomic DNA, 0.2 µM of each primer, 0.2 mM of each dNTP, 3 mM MgCl₂ for eight Loci (2 mM MgCl₂ for Locus 5280), 1 × FirePol® PCR buffer BD (0.8 M Tris–HCl, 0.2 M (NH₄)SO₄ and 0.5 U FirePol® Taq DNA polymerase (Solis Biodyne, Tartu, Estonia) under the cycling conditions described in Geist et al.^{15 (link)} and Geist & Kuehn^{16 (link)}. Forward primers were end-labelled with Cy5 fluorescent dye and PCR products were separated on 5% denaturing 19:1 acrylamid:bisacrylamid gels on an ALFexpressII DNA analyser (Amersham Pharmacia Biotech) and allele lengths were scored using ALLELELINKS 1.02 software. To ensure consistent allele scoring between individual lanes and among gels, two internal size standards were included per lane^{42 (link)} as well as 11 size standards and one previously genotyped reference sample in two separate lanes.