Mirna qrt pcr starter kit

The relative mRNA expression of circUbe3a, miR-138-5p, and RhoC was analyzed as previously described. Total RNA was extracted from cell lysates or SEVs using the TRIzol one-step method (Invitrogen, USA). The purity of the isolated RNA was determined by the optical density 260/280 ratio using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific). The isolated RNA was reverse transcribed using a MiRNA qRT-PCR Starter Kit (RiboBio, China). RT-qPCR analyses were performed using SYBR Premix Ex Taq II (TaKaRa). RNase R treatment was used for circRNA detection as previously described. Stem-loop RT-qPCR TaqMan MicroRNA assays (Life Technologies) were used to determine the miRNA amounts. GAPDH or U6 was used as the internal reference. All the primer sequences are listed in Table 1. Gene expression was quantified using the 2^-∆∆Ct method.

TRIzol Reagent (GLPBIO, Montclair, CA, USA) was used to extract RNA. The extracted total RNA concentration was determined, and then the RNA was reverse-transcribed into cDNA using a reverse transcription kit (Accurate Biology, Hunan, China). The miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China) was used to analysis miR-21-5p level, and U6 was used for the internal control for normalization purposes, and U6 was used as a control. Their sequences were as follows: miR-21-5p: AUCACAUUGCCAGGGAUUUCC; U6: forward: CGCTTCGGCAGCACATATAC; and U6: reverse: TTCACGAATTTGCGTGTCATC. The results were evaluated by using the 2-ΔΔCt method.

Total RNA was extracted using TRIzol reagent (Sangon, Shanghai, China) from cells or exosomes. The purity of the isolated RNA was determined by the optical density 260/280 ratio using the NanoDrop ND-2000 (Thermo Scientific). The isolated RNA was reverse transcribed using the miRNA qRT-PCR Starter Kit (Ribobio, China). RT-PCR was performed using the miRNA qRT-PCR Starter Kit on a 7500 Fast Real-Time PCR system following the manufacturer’s instructions. The relative expression levels of the genes were normalized to that of U6 by using 2 ^−ΔΔCt.