Dna isolation kit

Logarithmically growing BGC-823 were seeded in the 10 cm plates (1 × 10⁶), then transfected with 15μg pcDNA3.1flag empty plasmid or pcDNA3.1flag-p53 plasmid. After 48 h, cells were fixed with 1% final concentration formaldehyde solution, followed by sonicating with ultrasonic cell crusher on ice. Cells supernatants were incubated with anti-Flag antibody, and immunoprecipitation with Protein-A beads (Merck Millipore, USA). The beads were then washed with buffer and eluted with elution buffer. Then cross-links were reversed at 65 overnight. The DNA was purified with DNA isolation kit (Axygen, USA) and eluted with TE buffer (10mM Tris-HCl, 1mM EDTA, PH = 8.0). PCR was conducted using the following primers: forward, 5′-CGCTTACATAGTCAAACAGGTACT-3′, reverse, 5′-TCAAGCCTCTTGCTCCAACT-3′.

Logarithmically growing SGC-7901 were seeded in the 10 cm plates (1×10⁶), then transfected with 15μg empty plasmid or flag-STAT3 plasmid. After 48 h, cells were fixed with 1% final concentration formaldehyde solution, followed by sonicating with ultrasonic cell crusher on ice. Cells supernatants were incubated with anti-Flag antibody, and immunoprecipitation with Protein-A beads (Merck Millipore, USA). Subsequently, beads were washed with buffer and eluted with elution buffer. Then cross-links were reversed at 65°C overnight. The DNA was purified with DNA isolation kit (Axygen, USA) and eluted with TE buffer (10mM Tris-HCl, 1mM EDTA, PH=8.0). PCR was conducted using the following primers: forward, 5′- TGAGTTGACTCCGCCTCCAT-3′, reverse, 5′- TCCACTCCTTACTCTCCTGATGC -3′.

Ethylenediamine tetraacetic acid (EDTA) anticoagulated venous whole blood samples were collected from each participant. Human genomic DNA was extracted using the DNA Isolation Kit (Genomic DNA kit, Axygen Scientific Inc, CA, USA) according to manufacturers’ instruction. Laboratory staffs were blinded to the case–control status of these subjects for all subsequent genotyping described.