Log In Sign up
The largest database of trusted experimental protocols

Antibody against 6pgd

Manufactured by Novus Biologicals
Visit Supplier

The Antibody against 6PGD is a laboratory reagent designed to detect and quantify the presence of the enzyme 6-phosphogluconate dehydrogenase (6PGD) in biological samples. 6PGD is an important enzyme involved in the pentose phosphate pathway, which plays a crucial role in cellular metabolism and oxidative stress response. This antibody can be utilized in various analytical techniques, such as Western blotting, ELISA, and immunohistochemistry, to study the expression and distribution of 6PGD in different cell types and tissues.

Automatically generated - may contain errors

Lab products found in correlation

Antibody against β actin, by Merck Group (2 mentions) Compound c, by Merck Group (2 mentions) Phospho ampk t172, by Cell Signaling Technology (2 mentions) Phospho acc1 s79, by Cell Signaling Technology (2 mentions) Prediluted ki67 antibody, by Thermo Fisher Scientific (2 mentions) 1 hydroxy 8 methoxy anthraquinone s3, by Merck Group (2 mentions) Physcion, by Santa Cruz Biotechnology (2 mentions) A 769662, by LC Laboratories (2 mentions)

2 protocols using antibody against 6pgd

1

Stable Knockdown of 6PGD, G6PD, and AMPK

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable KD of endogenous h6PGD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT -3’). The shRNA is designed to target the 3' non-coding region of h6PGD-A mRNA and shows no effect on the plasmid directed expression of 6PGD cDNA in cells. Stable KD of endogenous hG6PD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT-3’). Stable KD of endogenous hAMPK was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGCATAATAAGTCACAGCCAAACTCGAGTTTGGCTGTGACTTATTATGCTTTTT -3’). Antibodies against AMPK (cat# 5831), phospho-AMPK (T172) (cat# 2535), ACC1 (cat# 3662), and phospho-ACC1 (S79) (cat# 11818), G6PD (cat# 12263), and LKB1 (cat# 3050) were from Cell Signaling Technology (CST); antibody against 6PGD was from Novus (cat# NBP1-31589); antibody against β-actin was from Sigma (cat# A1978); prediluted Ki67 antibody was from Invitrogen (cat# 08-0156). Physcion was purchased from Santa Cruz Biotechnology. 1-hydroxy-8-methoxy-anthraquinone (S3) was purchased Sigma. DHEA was purchased from Calbiochem. DHA was purchased from TCI America. A769662 was purchased from LC Laboratories. Compound C was purchased from EMD Millipore.
Elf S., Lin R., Xia S., Pan Y., Shan C., Wu S., Lonial S., Gaddh M., Arellano M.L., Khoury H.J., Khuri F.R., Lee B.H., Boggon T.J., Fan J, & Chen J. (2016). Targeting 6-phosphogluconate dehydrogenase in the oxidative PPP sensitizes leukemia cells to anti-malarial agent dihydroartemisinin. Oncogene, 36(2), 254-262.
+ Open protocol
+ Expand
2

Stable Knockdown of 6PGD, G6PD, and AMPK

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable KD of endogenous h6PGD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT -3’). The shRNA is designed to target the 3' non-coding region of h6PGD-A mRNA and shows no effect on the plasmid directed expression of 6PGD cDNA in cells. Stable KD of endogenous hG6PD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT-3’). Stable KD of endogenous hAMPK was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGCATAATAAGTCACAGCCAAACTCGAGTTTGGCTGTGACTTATTATGCTTTTT -3’). Antibodies against AMPK (cat# 5831), phospho-AMPK (T172) (cat# 2535), ACC1 (cat# 3662), and phospho-ACC1 (S79) (cat# 11818), G6PD (cat# 12263), and LKB1 (cat# 3050) were from Cell Signaling Technology (CST); antibody against 6PGD was from Novus (cat# NBP1-31589); antibody against β-actin was from Sigma (cat# A1978); prediluted Ki67 antibody was from Invitrogen (cat# 08-0156). Physcion was purchased from Santa Cruz Biotechnology. 1-hydroxy-8-methoxy-anthraquinone (S3) was purchased Sigma. DHEA was purchased from Calbiochem. DHA was purchased from TCI America. A769662 was purchased from LC Laboratories. Compound C was purchased from EMD Millipore.
Elf S., Lin R., Xia S., Pan Y., Shan C., Wu S., Lonial S., Gaddh M., Arellano M.L., Khoury H.J., Khuri F.R., Lee B.H., Boggon T.J., Fan J, & Chen J. (2016). Targeting 6-phosphogluconate dehydrogenase in the oxidative PPP sensitizes leukemia cells to anti-malarial agent dihydroartemisinin. Oncogene, 36(2), 254-262.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!