si-MT1 and si-Con were purchased from QIAGEN (Cat # 1027416). AML12 cells were transfected with si-Con and si-MT1 using Lipofectamine RNAi MAX (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions.
Si con
Manufactured by Qiagen
Sourced in United States
Si-Con is a lab equipment product designed for sample collection and preparation. It serves as a tool for processing biological samples prior to analysis or further experimentation. The core function of Si-Con is to facilitate the handling and processing of samples in a laboratory setting.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (6 mentions)
Si smile, by Qiagen (2 mentions)
Si con, by Thermo Fisher Scientific (1 mentions)
Superfect, by Qiagen (1 mentions)
Polyethylenimine (pei), by Polysciences (1 mentions)
Sicav1, by Horizon Discovery (1 mentions)
Recombinant tgf β1, by Thermo Fisher Scientific (1 mentions)
Rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions)
Allstars sirna, by Qiagen (1 mentions)
Shcon, by Merck Group (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
5 protocols using si con
1
Knockdown of MT1 in AML12 Cells
2
Transient Transfection of Hepatocyte Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human hepatoma cell lines (HepG2 and Huh7 cells) and a mouse immortalized hepatocyte cell line (AML12) were obtained from the ATCC and cultured as previously described [20 (link)]. SuperFect (QIAGEN, Hilden, Germany) or polyethylenimine (Polysciences, Inc., Warrington, PA, USA) were used for transient transfections according to each manufacturer’s recommendations. Small interfering RNAs (si-Con and si-SMILE) (QIAGEN) were transfected into HepG2 cells using Lipofectamine RNAi MAX (Thermo Fisher Scientific, Waltham, MA, USA). The luciferase assay was carried out as described previously [31 (link)]. In brief, HepG2 cells were transfected with indicated reporter plasmids together with vectors expressing SMILE, ALK3-CA, or HFE2 followed by treatment with BMP-6 or EGCG for 12 h.
3
Silencing CAV1 Modulates TGF-β1 Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After attachment, primary hepatocytes were cultured overnight with 10 nM siRNA targeting CAV1 (siCAV1, Dharmacon, Thermo Fisher Scientific, United States) and negative control siRNA (siCon, SI03650318, Qiagen) using RNAiMAX transfection reagent (Invitrogen, Darmstadt, Germany) according to the manufacturer’s instructions. Next day, the hepatocytes were treated with 5 ng/ml recombinant TGF-β1 (Peprotech, Hamburg, Germany) and cultured additional 48 h in starvation medium. For AML12 cells, 10 nM siCon and siCAV1 was transfected to the cells with Lipofectamine RNAiMAX reagent after attachment, and incubated for 24 h. Afterward, cells were cultured in starvation medium for 12 h, and subsequently treated with 5 ng/ml recombinant TGF-β1 for 24 h.
4
DYRK1B and GLI1 Silencing in Panc1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected with 35 nM siRNA (Dharmacon SMARTpools and Qiagen control siRNA using RNAiMax (Invitrogen). Control siRNA (siCon) was purchased from Qiagen (All-Stars-siRNA; siAll). The Dyrk1b-specific siRNA target sequences were: si1B_1: AUA CAGAGAUGAAGUACUA; si1B_2: GCACAUCAAU GAGGUAUAC; si1B_3: GAGAUGAAGUACUACAU AG; si1B_4: GGACAAAGGAACUCAGGAA: The mouse Gli2-specific and the human DYRK1B-specific siRNAs have been described before [14 (link), 48 ].
Short-hairpin RNA (shRNA) target sequences in pLKO. 1-puro backbone (Mission, obtained through Sigma) were as follows: shCon (SHC002; scrambled control): CAACAAGATGAAGAGCACCAA; shGFP (SHC005; targeting EGFP): TACAACAGCCACAACGT CTAT; shDYRK1B_1: GACCTACAAGCACATCAAT GA; shDYRK1B_3: CACGGAGATGAAGTACTATAT; shGLI1_1: CATCCATCACAGATCGCATTT. Panc1 cells were transfected on day 0 in 10% FBS media. Medium was changed to 0.5% FBS media and Puromycin (2 μg/ml) was added on day 1 (cells were kept like this until day 6). After recovery for 1 d in medium without selective pressure, cells were harvested on day 7 (for shDYRK1B) or day 9 (for shGLI1).
Short-hairpin RNA (shRNA) target sequences in pLKO. 1-puro backbone (Mission, obtained through Sigma) were as follows: shCon (SHC002; scrambled control): CAACAAGATGAAGAGCACCAA; shGFP (SHC005; targeting EGFP): TACAACAGCCACAACGT CTAT; shDYRK1B_1: GACCTACAAGCACATCAAT GA; shDYRK1B_3: CACGGAGATGAAGTACTATAT; shGLI1_1: CATCCATCACAGATCGCATTT. Panc1 cells were transfected on day 0 in 10% FBS media. Medium was changed to 0.5% FBS media and Puromycin (2 μg/ml) was added on day 1 (cells were kept like this until day 6). After recovery for 1 d in medium without selective pressure, cells were harvested on day 7 (for shDYRK1B) or day 9 (for shGLI1).
5
Silencing SMILE Gene in HepG2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNAs against control (si-Con) and human SMILE (si-SMILE) were purchased from QIAGEN (Cat. No. 1027416). HepG2 cells were transfected with si-Con and si-SMILE using Lipofectamine RNAi MAX (Thermo Fisher Scientific) according to the manufacturer’s instruction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!