To measure SOHLH2-induced Sycp1 promoter activity, a 572-bp fragment of Sycp1 promoter ([−470/+ 102] promoter) encompassing three putative E-boxes and transcription start site was PCR-amplified using the primers 5′-CTCGAGAGCACAGGACTCATGTTTGG-3′ and 5′-AAGCTTCGTGACAGAGGTGTGTACGTG-3′. The fragment was first cloned into pTOP TA V2 (Enynomics, Korea) and a 572 bp HindIII-XhoI fragment was subcloned into pGL4.10-luciferase vector (Promega, USA). The DNA fragment encoding SOHLH2 was synthesized using cDNA from mouse testes and cloned to pCMV-Tag 2A vector (Agilent Technologies, USA) to make FLAG-tagged SOHLH2 expression vector. HEK293T cells were seeded into 6-well plates at a density of 6 × 105 cells/well 24 hour prior to transfection. Cells were co-transfected with the indicated amount of SOHLH2 expression vector, 200 ng of Sycp1 promoter luciferase plasmid, and 50 ng of pRL-TK plsmid (Promega) using Lipofectamine 2000 (Invitrogen). After 2 days, cells were harvested, lysed, and analyzed for luciferase activity using dual-luciferase reporter assay system (Promega) and Centro XS3 LB960 microplate luminometer (Berthod Technologies, USA).
Pcmv tag 2a vector
Manufactured by Agilent Technologies
Sourced in United States
The PCMV-Tag 2A vector is a plasmid that enables the expression of multiple proteins from a single open reading frame. It features a cytomegalovirus (CMV) promoter and a 2A peptide sequence that facilitates the production of separate protein products from a single transcript.
Automatically generated - may contain errors
Lab products found in correlation
Pgl4.10 luciferase vector, by Promega (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 myc his vector, by Thermo Fisher Scientific (1 mentions)
2 protocols using pcmv tag 2a vector
1
SOHLH2-Induced Sycp1 Promoter Activity
2
Construction of miR-155 and FOXO3 Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the human FOXO3 recombined plasmid, the FOXO3 gene (NCBI Reference Sequence: NM_001455.3) was cloned into pCMV-tag2a vector (Agilent Technologies; Thermo Fisher Scientific, Inc.). A human genomic fragment of 65 bp containing the miR-155 precursor DNA sequence (NCBI Reference Sequence: NR_030784.1) was cloned into the pcDNA3.1(−)-myc-his vector (Invitrogen; Thermo Fisher Scientific, Inc.). The recombinant plasmid was pcDNA3.1-miR-155. The primers for construction were as follows; underlined nucleotides represent BamH I and HindIII sites: miR-155 P1, GATCCCTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATATTAGCATTAACAGA; miR-155 P2, AGCTTCTGTTAATGCTAATATGTAGGAGTCAGTTGGAGGCAAAAACCCCTATCACGATTAGCATTAACAGG; FOXO3-P1, ATTAGGATCCATGGCAGAGGCACCGGCTTC; and FOXO3-P2, GCAAAAGCTTTCCTGGCACCCAGCTCTGAG. To generate a cell line stably expressing miR-155, HT29 and SW620 cells were transfected with 200 ng pcDNA3.1-miR-155 using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Following 48 h transfection, following 800 mg/ml G418 selection, the single clone that over-expressed miR-155 was identified. For miR155 transient transfection, miR-155 mimics (Invitrogen; Thermo Fisher Scientific, Inc.) were used to transfect the 2 cell lines.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!