Pgem luc

Vectors used for in vivo experiments contained Fluc and Rluc genes amplified by polymerase chain reaction (PCR) from vectors pGEM-luc and pRL (Promega), respectively, and ligated into pET24a(+) (Novagen) (25 (link)). A fragment of the E. coli fdhF gene coding for amino acids 130–179 (Sec₁₄₀) was inserted between the two luciferase genes (Figure 1A). All other constructs were generated by introducing point mutations or deletions using PCR. For RF2 competition experiments, the E. coli prfb gene coding for RF2 was cloned into pETcoco-1 (Novagen), a C-terminal His-tag was added and 0-reading frame ensured by deletion of a T at the native +1 frameshifting site to increase expression (Figure 3A). The RF2 APA construct was generated by PCR.

Construction of pSO-luc was described previously [19 (link)]. Briefly, linker DNAs including the Shine-Dalgarno (SD) sequence (AGCTTAGTACTGGATCCGAGGACCTGCC and GATCGGCAGGTCCTCGGATCCAGTACTA) were synthesized (Sigma Genosys). pGEM-Luc (Promega, WI, USA) was digested with both BamH1 and HindIII and annealed linker DNA was inserted by ligation utilizing the ligation kit version 1 (Takara, Kyoto, Japan). The construct was then digested with HindIII and StuI and the gene fragment containing the SD sequence and the luciferase gene was inserted into pSO246 [20 (link)], which had been digested with BamH1, blunt-ended by T4 DNA polymerase, and digested with HindIII. This plasmid was designated as pSO-Luc. The promoter region of the gene encoding Mycobacterial DNA binding protein 1 (MDP1) [21 (link)] was cloned by polymerase chain reaction (PCR) using the following primers; 5’- GGGAAGCTTTCCCGATTTGGTGCATTTT and 5’- GGGGGATCCCGAAACCAGTGGTCCTCGTTTG targeting genomic DNA derived from BCG. The amplified DNA was digested with HindIII and BamHI and then inserted into the same site of pSO-Luc [20 (link)]. This recombinant BCG (rBCG) was designated as rBCG-MDP1-luc.

Chimeric 5′UTR-luciferase constructs were cloned by FastCloning using Phusion HF polymerase according to manufacturer’s protocol (NEB) (Li et al, 2011 (link)). pGEM-luc and pSP64 Poly(A) vectors were purchased from Promega. NotI and BglII sites were first cloned into pSP64 Poly(A) vector, and luciferase was cloned upstream of the poly(A) sequence. 5′UTR from intestine and kidney/liver isoforms were cloned from GeneBlocks (Integrated DNA Technologies) directly 5′ to the luciferase sequence. Plasmid sequences were all verified by Sanger sequencing across inserts.