A reference size key of FAFLP amplicon sizes was generated by analyzing single species with three to eight replicates per species using foliar DNA (Table 2 ; Fig. 1 ). PCR products were diluted 200× by combining 396 μL of distilled H2O and 2 μL of PCR product from each of the regions examined. From this dilution, 2 μL were added to 8 μL of Hi-Di Formamide and 0.3 μL of GeneScan 1200 LIZ Size Standard (Applied Biosystems). The final mixture was centrifuged for 30 s at 10,000 rpm, then denatured at 95°C for 2 min and coldsnapped to maintain single-stranded fluorescently labeled DNA. Sizes of pooled PCR amplicons were first resolved using capillary electrophoresis (ABI 3730 DNA analyzer, Applied Biosystems) and then sized with GeneMapper 4.0 software (Applied Biosystems) with GeneScan 1200 LIZ Size Standard (Applied Biosystems). Fragment sizes read by the capillary sequencer were rounded to the nearest base pair (Fig. 1 ).
Genescan 1200 liz size standard
Manufactured by Thermo Fisher Scientific
Sourced in United States
The GeneScan 1200 LIZ size standard is a molecular weight standard used in DNA fragment analysis. It contains a mixture of fluorescently labeled DNA fragments of known sizes, which are used to determine the size of unknown DNA fragments during capillary electrophoresis.
Automatically generated - may contain errors
Lab products found in correlation
Hi di formamide, by Thermo Fisher Scientific (2 mentions)
Genemapper software v4, by Thermo Fisher Scientific (2 mentions)
Abi 3730 dna analyzer, by Thermo Fisher Scientific (2 mentions)
Genemapper software, by Thermo Fisher Scientific (2 mentions)
3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Genemapper 4, by Thermo Fisher Scientific (1 mentions)
Abi 3730 sequencer, by Thermo Fisher Scientific (1 mentions)
Genemapper software version 3, by Thermo Fisher Scientific (1 mentions)
Abi 3730xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Abi 3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Abi 3730 capillary sequencer, by Thermo Fisher Scientific (1 mentions)
Gotaq dna polymerase, by Promega (1 mentions)
Peak scanner software, by Thermo Fisher Scientific (1 mentions)
Abi prism 3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Genescan 500 liz, by Thermo Fisher Scientific (1 mentions)
Dna ligation kit, by Takara Bio (1 mentions)
Phusion polymerase, by New England Biolabs (1 mentions)
17 protocols using genescan 1200 liz size standard
1
Amplicon Size Analysis for Species Identification
2
Molecular Marker-Based LMW-GS Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LMW-GS genes were detected using the LMW-GS gene molecular marker system [13 (link)]. PCR products were purified with 3.0 M sodium acetate and 70% ethanol before adding HiDi-formamide and GeneScan 1200 LIZ size standard (Applied Biosystems, Foster City, CA, USA). DNA fragments of LMW-GS genes were separated by capillary electrophoresis using a 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) with the default genotyping module and the G5 dye set. LMW-GS genes and allelic variants were designated in accordance with the size of their corresponding fragment lengths in the GeneMapper Software v3.7 (e.g., 385 and 397) [13 (link)].
3
Multi-Locus VNTR Analysis of Yersinia pestis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MLVA analysis with 26 markers (14+12) was performed as described by Li et al [5 (link)] with the following modifications on capillary electrophoresis. The forward primers were labeled with different fluorescent dyes, FAM or Hex. The PCR amplification was diluted with water to 1:80. After denaturing by heating, the amplicons were separated by capillary electrophoresis on an ABI 3730xl genetic analyzer with a GeneScan 1200 LIZ size standard (Applied Biosystems). The lengths of the amplicons were determined according to the sizes generated by GeneMapper software V. 4.0 (Applied Biosystems).
The profile data of MLVA (14+12) were compared using Bionumerics 6.6 (Applied Math). In addition to the VNTR data in our 23 Y. pestis isolates (S2 Table ), an additional 83 representative strains from previous MLVA (14+12) studies were also included for the cluster analysis[5 (link)] (S3 Table ). The genotyping criteria and naming refers to the paper of Cui et al [3 (link)]. The MLVA profiles were analyzed as a characteristic data using the alignment of the categorical coefficient and UPGMA (unweighted pair group method using arithmetic averages). The dendrogram was constructed using the minimum spanning tree (MST) by parameters (maximum and minimum neighbor distances were all selected as 1).
The profile data of MLVA (14+12) were compared using Bionumerics 6.6 (Applied Math). In addition to the VNTR data in our 23 Y. pestis isolates (
4
Standardized MIRU-VNTR Typing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standardized 24-loci MIRU-VNTR typing [7 (link)] was performed using the MIRU-VNTR typing kit (Genoscreen, Lille, France). PCR products were run with Genescan 1200LIZ size standard (Applied Biosystems, California, and USA) on ABI3730 sequencer. Sizing of the PCR fragments and assignment of MIRU-VNTR alleles were done by Gene Mapper software version 3.7 (Applied Biosystems, California, USA). In order to deine clusters and to build an UPMGA tree, we used the MIRU-VNTRplus web application available at http://www.miru-vntrplus.org/MIRU/index.faces . The allelic diversity of the strains was determined by using the Hunter Gaston Discriminatory Index (HGDI).
5
MLVA15 Typing of Bacillus anthracis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used MLVA with 15 markers, including eight initially described by Keim et al. and seven by Van Ert et al. [4 (link)]. The MLVA15 analysis was performed as described previously [4 (link), 12 (link)]. Brief description is as follows. The forward primers were labeled with the fluorescent dyes Fam or Hex. PCR amplifications were performed on a SensoQuest Labcycler (SensoQuest, Germany). The PCR products were analyzed by capillary electrophoresis on an ABI 3730xl genetic analyzer using a GeneScan 1200 LIZ size standard (Applied Biosystems). The lengths of the PCR products were determined according to their sizes using GeneMapper software V. 4.0 (Applied Biosystems). Selected PCR products were sequenced to verify the tandem repeat sequences. The electrophoretic band sizes in this study were corrected according to the sequencing results of the PCR products.
6
Fungal Diversity Analysis via ITS Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The diversity of fungal species in each sample was evaluated based on the length heterogeneity of the ITS1-5.8S rRNA-ITS2 region. This region was amplified using unlabeled ITS1-F and the universal fungal primer ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) labeled at the 5′ end with 6-carboxyfluorescein [11] (link). Amplification was performed in a 10 µl reaction mixture containing 1 µl of extracted DNA, 1 U of KOD Plus Ver. 2 polymerase (Toyobo, Osaka, Japan), and 10 pmol of each primer. Amplification conditions were 35 cycles of 94.0°C for 15 s, 57.4°C for 30 s, and 68.0°C for 60 s. The products were purified using a Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA). The purified amplicons were mixed with 10 µl of deionized formamide and 0.5 µl of GeneScan 1200 LIZ size standard (Applied Biosystems), denatured, and subjected to capillary electrophoresis using an ABI 3130 Genetic Analyzer (Applied Biosystems). The data were analyzed with GeneMapper Ver. 4.0 (Applied Biosystems). After the exclusion of fragments with a peak area <1% of the total, the LH-PCR profiles were aligned. Fragments with lengths that differed by one base or less were considered identical.
7
High-Resolution RT-PCR for HsfA7 Transcript
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High resolution reverse transcriptase PCR For high-resolution (HR) RT-PCR (Simpson et al., 2007) a gene-specific primer pair for HsfA7 was used, whereby the forward oligonucleotide was labeled with 6-carboxyfluorescein (fw: GACGGCGAAGAGGAAGATGTAG; rv: CCATAAACTTGATCAGGATCTGC). A thermal cycling profile consisting of: initial denaturation at 95 C for 3 min, followed by 95 C for 30 s, 58 C for 45 s, and 72 for 30 s for 30 cycles representing the linear phase of the reaction. RT-PCR products representing AS transcripts were detected on an ABI3730 DNA Analyzer along with GeneScan 1200 LIZ size standard (Applied Biosystems). Electropherograms were analyzed using GeneMapper v.4 software.
8
VNTR Analysis of M. tuberculosis Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
VNTR analysis of QUB11a from 312 M. tuberculosis isolates collected from humans in Fukuoka Prefecture (n = 306) and neighboring prefectures (n = 6), Japan, between 2012 and 2013 was performed as described previously [12 (link), 13 (link)]. The isolates were obtained from 312 newly diagnosed patients aged from 17 to 102 years (average: 68.3 years; median: 76 years) from eight separate hospitals (127 females and 185 males). In the same period, 944 patients were reported as newly diagnosed in Fukuoka Prefecture as a whole.
Amplification products corresponding to the QUB11a locus were analyzed by capillary electrophoresis (3500 Genetic Analyzer, Life Technologies, Carlsbad, CA, USA) and GeneMapper software (Life Technologies) to determine the fragment sizes (the combination of electrophoresis and measurement is hereafter referred to as capillary electrophoresis analysis). GeneScan 1200 LIZ Size Standard (Life Technologies) was used as an internal size marker. Analysis showed that 29 (9.3%) of the isolates produced large fragments (>1,200 bp) (Figure 1(a) ). These large fragments corresponded to a peak located outside of the internal size marker range of GeneMapper software (Figure 1(a) ) and therefore could not be measured. These 29 isolates were further analyzed in the following assays.
Amplification products corresponding to the QUB11a locus were analyzed by capillary electrophoresis (3500 Genetic Analyzer, Life Technologies, Carlsbad, CA, USA) and GeneMapper software (Life Technologies) to determine the fragment sizes (the combination of electrophoresis and measurement is hereafter referred to as capillary electrophoresis analysis). GeneScan 1200 LIZ Size Standard (Life Technologies) was used as an internal size marker. Analysis showed that 29 (9.3%) of the isolates produced large fragments (>1,200 bp) (
9
Multilocus VNTR Analysis of Francisella tularensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Determination of canSNPs status and assignment of strains to different phylogenetic branches were done according to [17 (link)]. For differentiation within subclades, MLVA was performed according to [18 (link)], using an additional twelfth marker Ft-M26 [17 (link)]. Fragment length determination was performed on the capillary sequencer ABI Genetic Analyzer 3100 using GeneScan 1200 LIZ Size Standard [both Life Technologies]. Fragment lengths were calibrated to in silico data of F. tularensis ssp. holarctica strain LVS and F. tularensis ssp. tularensis strain SchuS4.
10
Microbial Community Profiling by T-RFLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from luminal or stool samples was amplified with broad-range forward primer 8F (labeled with 6-carboxyfluorescein dye at the 5′ end) and reverse primer 1492R with GoTaq DNA polymerase (Promega, Madison, WI). The amplified PCR product was purified and digested by the MspI restriction enzyme (Promega, Madison, WI). The restriction digestion product was mixed with a GeneScan 1200 LIZ size standard (Life Technologies, Grand Island, NY) and deionized formamide. The length and intensity of terminal restriction fragments (T-RF) were determined on an ABI 3730 capillary sequencer (Life Technologies, Grand Island, NY) and analyzed with peak scanner software (Life Technologies, Grand Island, NY). The T-RF profiles were subjected to principal-component analysis (PCA) with the Excel add-in Multibase package (NumericalDynamics.Com, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!