Cytoflex cell analyzer

Manufactured by Beckman Coulter

Sourced in United States

The CytoFLEX cell analyzer is a flow cytometry instrument designed for the analysis of cells and particles. It utilizes advanced optical and fluidic technologies to provide accurate and reliable data on cellular properties such as size, granularity, and fluorescence characteristics.

Automatically generated - may contain errors

Lab products found in correlation

Operetta high content screening system, by PerkinElmer (1 mentions) Harmony 3, by PerkinElmer (1 mentions) Multitest imk kit, by BD (1 mentions) Cytoflex software, by Beckman Coulter (1 mentions) Uchl1, by BioLegend (1 mentions) Dreg 56, by BioLegend (1 mentions) Ebioscience foxp3 transcription factor staining buffer set, by Thermo Fisher Scientific (1 mentions) Ebioscience fixable viability dye efluor 506, by Thermo Fisher Scientific (1 mentions) Anti mouse cd16 cd32 2.4g2, by BD (1 mentions) Lsm 710, by Zeiss (1 mentions) Ze5 cell analyzer, by Bio-Rad (1 mentions) Aria fluorescence activated cell sorter, by BD (1 mentions) Facsaria 3 cell sorter, by BD (1 mentions) Papain dissociation system, by Worthington (1 mentions)

Spelling variants of this product

CytoFLEX (3035 citations) CytoFLEX analyzer (29 citations) Cytoflex S cell analyzer (2 citations)

9 protocols using cytoflex cell analyzer

CRISPR Efficiency Evaluation in Reporter Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

TLR reporter cell line were pre-seeded and transfected with various Cas9 constructs and sgRNA with or without GFP donor template (Addgene plasmid #31475¹⁹ (link)). Flow cytometry analysis of GFP-positive cells was performed using CytoFLEX cell analyzer (Beckman Coulter) to assess HDR efficiency. At least 50,000 cells from each well were analyzed. To assess NHEJ efficiency, mCherry signal was analyzed using Harmony 3.5 (PerkinElmer) after image acquisition with Operetta High Content Screening system (PerkinElmer).

Zhao C., Zhao Y., Zhang J., Lu J., Chen L., Zhang Y., Ying Y., Xu J., Wei S, & Wang Y. (2018). HIT-Cas9: A CRISPR/Cas9 Genome-Editing Device under Tight and Effective Drug Control. Molecular Therapy. Nucleic Acids, 13, 208-219.

+ Open protocol

+ Expand

Characterization of T Cell Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols

We measured CD4⁺ and CD8⁺ T cell activation at BL, 4W, 12W, and 24W. The PBMCs were washed and stained with Fixable Viability-R763-APCA750, anti-CD3-NUV750, anti-CD4-B525-FITC, anti-CD8-V763, anti-CD38-Y585-PE, and HLA-DR-Y763-PC7 (all from BD Pharmingen,USA). The expression of CD38⁺ and HLA-DR⁺ on CD4⁺ and CD8⁺ T cells was measured with a CytoFLEX cell analyzer (Beckman Coulter). Data were analyzed using the FlowJo V10 analysis platform. CD4⁺ T cell counts were measured by the BD Multitest IMK Kit on flow cytometry.

Liu X., Zhu X., Peng X., Tao R., Wan Z., Hui J., Guo Y., Hang Y, & Zhu B. (2022). Lenalidomide potentially reduced the level of cell- associated HIV RNA and improved persistent inflammation in patients with HIV-associated cryptococcal meningitis a pilot study. Frontiers in Cellular and Infection Microbiology, 12, 954814.

+ Open protocol

+ Expand

Analyzing CAR-T Cell Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols

CAR-T cells were pre-labeled with the intracellular fluorescent label carboxyfluorescein diacetate succinimidyl ester. Covalently bound carboxyfluorescein diacetate succinimidyl ester is divided equally between daughter cells, enabling the discrimination of successive cell division rounds. After culturing labeled CAR-T cells with Raji cells at an E/T ratio of 1:2 for 24 hours, samples were analyzed by flow cytometry analysis by staining with APC labeled anti-human CD3 antibody (clone HIT3a, BioLegend). The proliferation assays and carboxyfluorescein diacetate succinimidyl ester-staining were performed in the continuous presence of IL-2.
FITC-labeled anti-human CD4 antibody (clone OKT4, BioLegend) and PerCP-Cyanine5.5-labeled anti-human CD8 antibody (clone SK1, BioLegend) were used to detect CD4+/CD8+ T cells by FLOW CYTOMETRY ANALYSIS.
PE/Cyanine7-labeled anti-human CD45RO antibody (UCHL1, BioLegend) and PE-labeled CD62L antibody (DREG-56, BioLegend) were used to differentiate memory and effector T cell populations; central memory T (T_CM) cells were defined as cells expressing CD45RO and CD62L.
Flow cytometry analysis was conducted on a CytoFLEX Cell Analyzer (Beckman Coulter), and data were analyzed using CytoFLEX Software (Beckman Coulter).

Zhang J., Zhu J., Zheng G., Wang Q., Li X., Feng Y., Shang F., He S., Jiang Q., Shi B., Wang D., Cao Z, & Wang J. (2022). Co-Expression of miR155 or LSD1 shRNA Increases the Anti-Tumor Functions of CD19 CAR-T Cells. Frontiers in Immunology, 12, 811364.

+ Open protocol

+ Expand

Multiparametric Flow Cytometry for Immune Cell Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were suspended in PBS containing 2% FBS and stained with fluorescent-labeled anti-mouse surface molecule antibodies: CD4 (RM4-5)/PerCP, CD25 (PC61)/BV421, CD8 (53-6.7)/FITC, TNFR2 (TR75-89)/PE, and CD90.2 (30-H12)/PE (BioLegend, San Diego, CA). Live cells were stained by eBioscience Fixable Viability Dye eFluor 506 (Thermo Fisher Scientific). Anti-mouse CD16/CD32 (2.4G2) (BD Biosciences) was used for Fc blocking. For intracellular staining, anti-Foxp3 (FJK-16s)/APC (Thermo Fisher Scientific), anti-Foxp3 (ME-14)/BV421, anti-IL-4 (11B11)/PE, anti-Ki-67 (16A8)/PE (BioLegend), anti-IL-17(TC11-18H10)/PE (BD Biosciences), anti-phospho-IκB alpha (Ser32, Ser36) (RILYB3R)/eFluor 660 (Thermo Fisher Scientific), and anti-phospho-IKKα/β (Ser176/180) (16A6) /PE (Cell Signaling Technology) were used after fixation and permeabilization with an eBioscience Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) according to the manufacturer’s protocol. Isotype controls matched for each antibody were used. For human molecule staining, anti-CD4 (RPA-T4)/APC (BioLegend), anti-Foxp3 (PCH101)/PE (eBioscience), and anti-TNFR2 (hTNFR-M1)/BV421 (BD Biosciences) were used. FCM was performed using a CytoFLEX cell analyzer (Beckman Coulter, Brea, CA). Data were analyzed using FlowJo software (BD Biosciences).

Inoue M., Tsuji Y., Ueno R., Miyamoto D., Tanaka K., Moriyasu Y., Shibata S., Okuda M., Ando D., Abe Y., Kamada H, & Tsunoda S.I. (2023). Bivalent structure of a TNFR2-selective and agonistic TNF-α mutein Fc-fusion protein enhances the expansion activity of regulatory T cells. Scientific Reports, 13, 13762.

+ Open protocol

+ Expand

Efficient HDR-mediated Gene Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

FCR stable cell line was co-transfected with various Cas9 constructs and BFP sgRNA and single strand DNA (ssDNA) donor template. The sequence of donor was 5′-GCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACGTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGA-3′²¹ (link) (synthesized by Sangon Biotech). To measure HDR efficiency, flow cytometry analysis for GFP-positive cells was conducted using CytoFLEX cell analyzer (Beckman Coulter). 30,000 cells at minimum from each well were analyzed.

+ Open protocol

+ Expand

Flow Cytometry and Confocal Microscopy Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flow cytometry data was collected using the following instruments: 5
laser (355, 405, 488, 561, and 640 nm) Bio-Rad ZE5 cell analyzer, 4 laser
(405, 488, 561, and 640 nm) Bio-Rad ZE5 cell analyzer, 4 laser (405, 488,
561, 640) Beckman Coulter Cytoflex cell analyzer. FACS was performed using a
3-laser (405, 488, and 633 nm) BD Biosciences Aria fluorescence-activated
cell sorter.
Confocal microscopy data was collected using a Zeiss LSM 710 laser
scanning confocal microscope with a 40x oil-immersion objective lens.

Edgar L.J., Kawasaki N., Nycholat C.M, & Paulson J.C. (2018). Targeted Delivery of Antigen to Activated CD169+ Macrophages Induces Bias for Expansion of CD8+ T cells. Cell chemical biology, 26(1), 131-136.e4.

+ Open protocol

+ Expand

Dissociation and Flow Cytometry of Glioblastoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

GBM regions from Luc positive mice were acutely dissected under fluorescent microscope and enzymatically dissociated into single-cell suspensions using the Papain Dissociation system (Worthington Biochemical). The same areas from the control mice were parallelly dissociated into single-cell suspensions to set up voltage parameters and all gates. Flow cytometry was performed on a BD LSRFortessa X-20 Cell Analyzer or a Beckman Cytoflex Cell Analyzer. Cell sorting was performed on a BD FACSAria III Cell Sorter. Every experimental group used 3 million cells for flow cytometry analyses.

Wang F., Liu X., Li S., Zhao C., Sun Y., Tian K., Wang J., Li W., Xu L., Jing J., Wang J., Evans S.M., Li Z., Liu Y, & Zhou Y. (2022). Resolving the lineage relationship between malignant cells and vascular cells in glioblastomas. Protein & Cell, 14(2), 105-122.

+ Open protocol

+ Expand

Analyzing Extracellular Vesicles by Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flow cytometry analysis of EV preparations was performed with a CytoFLEX cell analyzer (Beckman Coulter, Brea, CA, USA) as previously described [52 (link)] with slight modifications. Briefly, 15 µL of purified EV suspensions were stained in 45 µL final volume with optimal dilutions of CD81 APC clone JS64 and CD63 PE clone CLBGran/12. Relevant isotype antibodies were used at the same dilutions to ensure specific staining of EV and to evaluate background fluorescence, which served also to set threshold triggering on the CD81 APC channel [53 (link)]. Instrument calibration was performed by running Apogee beads (Apogee Flow Systems Ltd., Hertfordshire, UK) with the same instrument settings. All antibodies were from Beckman Coulter.

Baldari S., Di Rocco G., Magenta A., Picozza M, & Toietta G. (2019). Extracellular Vesicles–Encapsulated MicroRNA-125b Produced in Genetically Modified Mesenchymal Stromal Cells Inhibits Hepatocellular Carcinoma Cell Proliferation. Cells, 8(12), 1560.

+ Open protocol

+ Expand

Flow cytometric analysis of macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

The upper chamber RAW264.7 macrophages were washed twice with cold PBS buffer. After centrifugation, the supernatant was removed and the pellet was resuspended in PBS buffer. Then, cells were incubated with F4/80 monoclonal antibody (17–4801-80, Invitrogen, USA) (APC conjugated), CD11c monoclonal antibody (FITC conjugated) (11–0114-81, Invitrogen, USA), and CD11b monoclonal antibody (12–0112-81, Invitrogen, USA) (PE-conjugated). Cells were analyzed on a CytoFLEX Cell Analyzer (Beckman, USA) with post-processing in CytExpert software.

Zhou C., Chen R., Gao F., Zhang J, & Lu F. (2020). 4-Hydroxyisoleucine relieves inflammation through iRhom2-dependent pathway in co-cultured macrophages and adipocytes with LPS stimulation. BMC Complementary Medicine and Therapies, 20, 373.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!