Chromo4

BMSC culture, RNA isolation, and quantitative analysis of levels of mRNA expression were performed as described previously using TaqMan Reverse Transcription Reagents (Applied Biosystems) and a Chromo-4 real-time RT-PCR instrument (MJ Research) (23 (link)). The mRNA levels were normalized to β-actin (internal control) and gene expression was presented as fold changes (ΔΔ Ct method). The primer sequences used in the PCR reactions are: Runx2: 5′-CCACCACTCACTACCACACG-3′ (forward) and 5′-TCAGCGTCAACACCATCATT-3′ (reverse); Colla1: 5′-CACCCTCAAGAGCCTGAGTC-3′ (forward) and 5′-CGGGCTGATGTACCAGTTCT-3′ (reverse); ALP: 5′-AACCCAGACACAAGCATTCC-3′ (forward) and 5′-CCAGCAAGAAGAAGCCTTTG-3′ (reverse); Ocn: 5′-TTCTGCTCACTCTGCTGACC-3′ (forward) and 5′-TTTGTAGGCGGTCTTCAAGC-3′ (reverse); PPARγ2: 5′-TTTTCCGAAGAACCATCCGAT-3′ (forward) and 5′-ACAAATGGTGATTTGTCCGTT-3′ (reverse); β-actin: 5′-CTGGCACCACACCTTCTACA-3′ (forward) and 5′-GGTACGACCAGAGGCATACA-3′ (reverse).

Total RNA was isolated according to the manufacturer’s protocol (RNeasy Minikit, Qiagen). After RNA reverse transcription, 1 μl of each cDNA preparation was PCR-amplified using the set of primers described below. The tachykinin receptor 3 primmer: 5’-TTGCAGTGGACAGGTATATG-3’ and 5’-GATGTGGTGGAGGCAGATTT-3’, NFATc1 primer: 5’- CAAGTCTCTTTCCCCGACATC-3’ and 5’- CTGCCTTCCGTCTCATAGTG-3’. The condition of quantitative real-time PCR (qPCR) were as follows: 40 cycles of 95°C for 30 seconds 60°C for 30 seconds, and 72°C for 30 seconds for tachykinin receptor 3 or 37 cycles of 95°C for 5 seconds and 62°C for 30 seconds for NFATc1. Melting curves were obtained, RT-qPCR was performed on the chromo4 (MJ Research, Waltham, MA, USA) using a SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Inc. Philadelphia, PA), and the data was analyzed by using ΔΔCT methods.

For the quantitative RT-PCR analyses, the Maxima SYBR Green Kit (Fermentas Inc., USA) and the Bio-Rad Chromo4 thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA) were used. Protocol started with 5 min enzyme activation at 95 °C, followed by 40 cycles at 95 °C for 15 s, 56 °C for 20 s, and 72 °C for 40 s, and the final elongation at 72 °C for 5 min. Melting curve analysis was used for amplicon verification. The expressions of TBP (TATA-box-binding protein) and PBGD (porphobilinogen deaminase) were used to normalize the data. The Pfaffl comparative method was used for fold-change quantification. Primers were designed using the Beacon Designer software and subjected to a BLAST search to minimize unspecific binding. Only the primer pairs that generated intron-spanning amplicons were selected. The sequences of primers used to analyze Nrf2, NF-κBp65, NF-κBp50, SOD-1, NQO1, COX-2, TBP, and PBGD genes are listed in Table 2.

Total RNA was extracted from leaf tissue using TRIzol® Reagent (Invitrogen, Cat. 15596‐026) and cDNA prepared using the Superscript III™ Reverse Transcriptase kit (Invitrogen, Cat. 18080–044). A 1/10 dilution of the reverse transcription final reaction was prepared; 1 μl of the dilution was used as template for the qPCR consisting of 0.4 μm of each primer and 1× SYBR Green Master Mix (QuantiTect® SYBR® Green PCR Kit; Qiagen, Cat. 2041453), using a Bio‐Rad Chromo 4 with Opticon Monitor 3 software (Bio‐Rad Laboratories, Inc., California). Serial dilutions of corresponding amplification product were used to monitor the amplification efficiency and to transform threshold cycles into concentrations. The PCR conditions were 15 min at 95°C and then 40 cycles of 15 s at 95°C, 30 s at 58°C, and 30 s at 72°C. Transcript levels were normalized to the expression level of α‐tublin (U40042). Primers were as follows: lipoxygenase 2.A (HvLOX2, gene bank AK362687) AGTACCTGGGAGGGATGGAG (forward) and TGGTTTCATGAGCTGGTACG (reverse); allene oxide cyclase (HvAOC, gene bank AJ308488) GCTACGAGGCCATCTACAGC (forward) and AAGGGGAAGACGATCTGGTT (reverse); 60‐kDa JIP (HvJIP60, gene bank BM815987) CAGCAGCGACTTCATTTACA (forward) and ATGGTGTCGCAGACTATCCT (reverse); α‐tubulin (Hvα‐TUB, gene bank U40042) AGTGTCCTGTCCACCCACTC (forward) and AGCATGAAGTGGATCCTTGG (reverse).

In order to validate the differential expression of a set of immune response mediator genes, qRT-PCRs were carried out on IPPs, JPPs and MLNs from a group of 70-day-old pigs. Three genes, β-2-microglobulin (B2M), hydroxymethylbilane synthase (HMBS) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were used as reference genes because of their stable expression between samples as evaluated using the geNorm algorithm^{26 (link)}. All gene primers (Supplementary Table S3) were designed using the Clone Manager 9 software (Scientific & Educational Software, Cary, NC, USA). For cDNA synthesis, one µg of total RNA was reverse transcribed for 90 min at 37 °C in a 20 µl volume containing 0.25 mM dNTP of OligodT, 25 U of MuMLV reverse transcriptase in 4 µl 5X MuMLV buffer (Eurogentec, Liège, Belgium). After heat-inactivation at 93 °C for 5 min, generated cDNA was stored at −80 °C until use. qRT-PCRs were performed on a Bio-Rad Chromo 4 apparatus (Bio-Rad, Hercules, CA, USA) using the Mesa Green qPCR MasterMix Plus for SYBR assay (Eurogentec, Liège, Belgium) as previously described^{27 (link)–29 (link)}. All qRT-PCRs displayed efficiency between 90 and 110%, and expression data were given as relative values using modified delta delta Ct method^{30 (link)} after Genex macroanalysis (Bio-Rad, Hercules, CA, USA)^{26 (link)}.

Cells cultured for 1 week in the presence of physiological glucose or hypoglycemia and 10 nM CRT0063465 were harvested at 70%–80% confluence, fixed in formaldehyde and lysed in SDS buffer with protease inhibitors. Chromatin fragments (500 bp-1 kb) were generated by sonication using a Branson S25OD sonifier (Branson Ultrasonics Corp., Danbury, CT). Antibodies were Ab13579, TRF2; Ab67355, PGK1; Ab131591, DJ1 (Abcam, Cambridge, UK). Each assay included no-antibody control. Telomeric DNA was detected by Q-PCR in triplicate using sybr green and Chromo4 equipment (BioRad Laboratories Ltd., Hemel Hempstead, UK). Primers were 5′-CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT-3′ and 5′-GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT-3′. Experiments were performed three times with qPCR in triplicate on each occasion.