The total RNA was manually isolated from the cumulus cells using Trizol reagent (Sigma Pool, UK) following the manufacturer’s protocol. The transcript nova kit (Qiagen Inc., Valencia, CA, USA) was used for reverse-transcription of obtained RNA into cDNA as a described previously [20 (link)]. The reverse-transcribed yields of Ahr, Arnt, Cyp1A1, and Cyp1B1, were amplified by real-time polymerase chain reaction (PCR) with SYBR Green (Takara, Japan) on an ABI real-time PCR system (Applied Biosystems, ABI, Foster City, CA, USA), according to the manufacturer’s instructions. Finally, all data were analyzed by the standard formula, while glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as an internal reference gene. Primer sequences were as follows: human AHR (sense, 5´-AGAGTTGGACCGTTTGGCTA-3´; antisense, 5´AGTTATCCTGGCCTCCGTTT-3´), human ARNT (sense, 5´- CAAGCCCCTTGAGAAGTCAG-3´; antisense, 5´-GGGGTAGGAGG GAATGTGTT-3´), human CYP1A1 (sense, 5′-TCA ATC AAG AGG CGC GAA CCT C-3′; antisense, 5′-CTA CAG CCT ACC AGG ACT CG-3′, human CYP1B1 (sense, 5´-AAGTTCTTGAGGC ACTGCGAA-3´; antisense, 5´-GGCCGGTACGTTCTCCAAAT-3´), and human GAPDH (sense, 5´-TGGACCTGACCTGCCGTCTA-3´; antisense, 5´-CTGCTTCACCACCTTCTTGA-30).
Abi real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China
The ABI Real Time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is used to quantify and detect nucleic acid sequences in a sample. The system includes a thermal cycler, optics for fluorescence detection, and software for data analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Sybr green master mix, by Thermo Fisher Scientific (10 mentions)
Rneasy kit, by Qiagen (10 mentions)
Superscript 2 rt kit, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Transcript nova kit, by Qiagen (2 mentions)
Sybr green, by Takara Bio (2 mentions)
Iscript reverse transcription supermix, by Bio-Rad (2 mentions)
Sybr select master mix, by Thermo Fisher Scientific (2 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (2 mentions)
Taqman reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Primescript rt kit, by Takara Bio (2 mentions)
Blood and tissue kit, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Iscript reverse transcription supermix kit, by Bio-Rad (2 mentions)
Reverse transcription enzyme, by Thermo Fisher Scientific (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
51 protocols using abi real time pcr system
1
Quantitative RT-PCR Analysis of AhR Pathway Genes
2
Gene Expression Analysis by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels of TGF-β1, connective tissue growth factor (CTGF), vascular cellular adhesion molecule-1 (VCAM-1), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), cyclooxygenase-2 (COX-2), α-smooth muscle actin (α-SMA), E-cadherin, collagen I, and collagen III were determined by real-time PCR with the specific primers (Table S1 and Table S2 ) under ABI Real-Time PCR System (Applied Biosystems) as we previously depicted [41 (link)].
3
Quantitative Real-Time PCR of ABCG2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative real-time PCR (qRT-PCR), healthy animals (Ctrl.) or animals during the acute (16 or 18 days after immunization) or chronic (26 days after immunization) phase were perfused with PBS. The spleen, isolated T cells from the spleen diluted in RLT buffer (Qiagen, Germany), spinal cord tissue, and liver were frozen in liquid nitrogen and stored at − 80 °C. Microvessels from the spinal cord and brain were isolated as previously described [20 (link)]. RNA was isolated using TRIZOL followed by the RNAeasy Kit Mini (Qiagen, Germany) and transcribed to cDNA according to the manufacturer’s protocol (Super Mix; Quanta Biosciences, USA). QRT-PCR was performed on an ABI real-time PCR system (Applied Biosystems, Darmstadt, Germany) using PerfeCTa FastMixII master mix (Quanta Bioscience) and abcg2-primer (5′→3′ sense-GCA CCT CAA CCT GCC CAT T; antisense-TCA GGG TGC CCA TCA CAA C; FAM-CAT CTT GAA CCA CAT AAC CTG AAC AGC ATT TG; Microsynth, Baldgach, Switzerland), normalized to the housekeeping gene β-actin (primer: Mm00607939_s1 Actb, Applied Biosystems) using the ΔΔct method.
4
Quantitative RT-PCR Analysis of DCAF16 and DTL Expression
5
Quantitative PCR Analysis of Skin Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was carried out to confirm the expression levels of several genes in vitro and in vivo. Total RNA was isolated from dorsal skin tissues and HaCaT cells using 1 ml Trizol reagent (Invitrogen, Carlsbad, CA, USA). After the RNA was extracted, cDNA was synthesized using the Prime Script ™ II 1st strand cDNA synthesis kit (Takara Bio, Inc. USA), according to the manufacturer’s protocols. The cDNA was amplified with SYBR Green PCR Master Mix (Applied Biosystem, CA, USA) using an ABI Real-Time PCR system (Applied Biosystems, Inc., CA, USA). The primer sequences are shown inTable 2
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of different tissues was extracted (RNAeasy kit, QIAGEN) and the commensurable RNA of each sample was reverse-transcribed to first-strand cDNA and were diluted to the same multiples for the template for gene expression analysis (TaqMan reverse transcription kit, Applied Biosystems). The qPCR system containing 10 μl of SYBR Green mix (Roche, Mannheim, Germany), 2 μl of template, and 0.2 μM primers was conducted using the ABI real-time PCR system (Applied Biosystems, Foster City, CA). Three technical replicates of each reaction were performed. Transcript levels of each sample were determined and normalized with respect to the internal control gene using the ΔΔCt method (Czechowski et al., 2005 (link); Schmittgen and Livak, 2008 (link); Chen et al., 2015 (link)). The specific primers used for RT-qPCR are shown in Table S2
7
Exosome miRNA/mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from exosomes or PIG1 cells using TRIzol (Qiagen, USA). The RNA concentration was detected by NanoDrop (Thermo, USA). Then, total RNA was reverse-transcribed to cDNA by PrimeScript RT kit (Takara, Japan). RT-qPCR was implemented on ABI Real-Time PCR System (Applied Biosystems, USA) using SYBR Green Master Mix or TaqMan MicroRNA Assay Kit (Takara, Japan). MiRNA or mRNA expression levels were calculated using 2−ΔΔCT method and were normalized to U6 or β-actin. The primer sequences used in the study are listed in Table 2 .
The data were presented as means ± SEM. The differences among multiple groups were analyzed using a one-way ANOVA followed by a Tukey’s post hoc test and the differences between two groups were analyzed using a paired student’s t-test. Differences were considered statistically significant at the level of P < 0.05.
The data were presented as means ± SEM. The differences among multiple groups were analyzed using a one-way ANOVA followed by a Tukey’s post hoc test and the differences between two groups were analyzed using a paired student’s t-test. Differences were considered statistically significant at the level of P < 0.05.
8
Oocyte RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After denuding and washing of mature oocytes, 10-15 oocytes were accumulated four times, and total RNA was isolated from these accumulations. The RNeasy Micro kits (Qiagen Inc., Valencia, CA, USA) and transcript nova kit (Qiagen Inc., Valencia, CA, USA) were used for RNA isolation and reverse-transcription into cDNA as a described previously (20). The reverse-transcribed yields of two subunits of maturation-promoting factor (MPF: Cdk1, cyclin B), mitogen-activated protein kinase (Mapk), Cyclooxygenase (Cox2), Glutathione peroxidase (Gpx1), DNA methyltransferase-1 (Dnmt1) and histone deacethylase-1 (Hdac1) were amplified by real-time polymerase chain reaction (PCR) with SYBR Green (Takara, Japan) on an ABI real-time PCR system (Applied Biosystems, ABI, Foster City, CA, USA), according to the manufacturer's instructions. Finally, all data were analyzed by the standard formula, while glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as an internal reference gene. The details of real-time PCR reaction was described in our previous article (17). Table I lists the primer sequences.
9
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by an RNeasy Kit (Qiagen) according to the manufacturer’s protocol. RNA was spectrophotometrically quantified and equal amounts were used for cDNA synthesis with the Superscript II RT Kit (Invitrogen). qPCR analysis was performed on an ABI Real Time PCR System (Applied Biosystems) with the SYBR green Mastermix (Applied Biosystems). The primers used are: hSQLE-F, tccttgctcaggctctttatg; hSQLE-R, agggttaggagacaatacagaaag; HSD17B7-F,gaccttttgagtgtggctttg; HSD17B7-R, acggaggcagaattccatatg; RPLO-F, cctctttcccttcggtgtg; RPL0-R, aatcttggcatcagggacac; NPM-F, gggccagtgcatattagtgga; ALK-R, tgtactcagggctctgcagct; hACTINB-F, ttttggctataccctactggca; hACTINB-R, ctgcacagtcgtcagcatatc; mSQLE-F, cccaaaacacaaaatcctcag; mSQLE-R, gcaatgccaagaaaagtccac; mACTINB-F, gttgtgaatgtattggctcagg; mACTINB-R, aatattgaaagcaacccaacagg. Results were normalized to RPL0 or ACTINB.
10
Quantifying Gene Expression in Mouse Skin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression in dorsal skin was detected by RT-qPCR. Total RNA was extracted from the mouse dorsal tissue using an RNAeasyTM Animal RNA Extraction Kit (Beyotime, Beijing, China) according to the manufacturer’s instructions. According to the operating procedure of the MonScriptTM RTIII All-in-One Mix (Monad Biotech Co., Ltd., Suzhou, China), the operation was performed according to the specified conditions to convert RNA into cDNA. Furthermore, the cDNA analysis was performed with MonAmpTM qPCR Mix using the ABI Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The primer sequences are shown in Table 1 . The RNA gene expression levels of each sample were analyzed three times and normalized to the internal control gene GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!