The largest database of trusted experimental protocols

5 protocols using aldh2

1

Western Blot Antibody Reagents for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies that were used for western blot analysis are: phos-TFEB (Calbiochem, ABE1971), TFEB (Bethyl, A303–673A), β-Actin (Sigma, A5441), GAPDH (Cell Signaling, 2118), p62 (Abnova, H00008878-M01), phos-s6-ribosomal protein (Cell Signaling, 4858), s6-ribosomal protein (Cell Signaling, 2217), phos-4EBP1 (Cell Signaling, 9451), 4EBP1 (Cell Signaling, 9452), phos-ERK (Cell Signaling, 9101), ERK (Cell Signaling, 9102), Lamin A/C (Cell Signaling, 2032), Lamp1 (DSHB, 1D4B), CYP2E1 (Abcam, ab28146), ALDH2 (Proteintech, 15310–1-AP). Anti-myeloperoxidase (MPO, # PP023AA) was from Biocare Medical. Antibodies for vacuolar ATPase H+ Transporting V1 Subunit A (V-ATP6V1a) and vacuolar ATPase H+ Transporting V1 Subunit B2 (V-ATP6V1b2) are kindly provided by Dr. Dennis Brown at Harvard Medical School. The Anti-LC3 antibody was generated as previously described (Ding, Li et al. 2010 (link)). HRP-conjugated secondary antibodies were from Jackson ImmunoResearch.
+ Open protocol
+ Expand
2

Liver Protein Immunoblotting Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Proteins from either whole liver extracts or subcellular fractions were subjected to standard SDS-PAGE and transferred to PVDF (GE Healthcare, Picataway, NJ). Membranes were processed using the following antibody dilutions: ALDH2, 1:2000, Cat #15310 (Protein Tech Rosemont, IL.), AHD1, 1:1000 Cat#GTX62515 (Genetex, Irvine, CA.), beta actin 1:5000, Cat#A5441 (SIGMA, Saint Louis, MO) as previously described [15 (link), 19 (link), 22 (link), 24 (link)]. Chemiluminescence was visualized using either film or a Storm 860 scanner from Molecular Dynamics (Sunnyvale, CA).
+ Open protocol
+ Expand
3

Antibodies for Western Blot and IHC Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The primary antibodies used in western blot analysis included PD‐L1 anti‐human (#13684, CST), PD‐L1 anti‐mouse (17952‐1‐AP, Proteintech), ALDH2 (15310‐1‐AP, Proteintech), Myc tag (#2278, CST), Flag tag (20543‐1‐AP, Proteintech), HA tag (51064‐2‐AP, Proteintech), SPOP (16750‐1‐AP, Proteintech), and GAPDH (60004‐1‐Ig, Proteintech). Antibodies used in IHC assay were anti‐mouse CD3 (ab16669, Abcam), anti‐mouse CD8 (ab209775, Abcam), anti‐mouse granzyme B (ab4059, Abcam), anti‐human CD3 (Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing, China), and anti‐human CD8 (Zhongshan Golden Bridge Biotechnology Co., Ltd.). The secondary antibodies used in immunofluorescence assay were AF488‐anti‐rabbit (#8878, CST) and AF594‐anti‐mouse (Biotech). MG‐132 (M8699) and chloroquine (C6628) were purchased from Sigma. CHX (HY12320) was purchased from MedChem Express.
+ Open protocol
+ Expand
4

Western Blot Analysis of Cellular Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
NuPAGE 4–12 % Bis-Tris gel (Invitrogen) was used to separate cell protein lysates, which were then transferred to PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked and then kept at 4 °C with the primary antibodies listed below: P-AMPK (1:1000), P-ACC (1:1000), P-JNK (1:1000), P-P38MAPK (1:1000), G6PD (1:1000), BCL-2 (1:1000), BCL-XL (1:1000), SIRT2 (1:1000) and cleaved caspase 3 (1:1000) (Cell signaling Technology, Danvers, MA, USA); cytochrome c (1:2000) (BD Biosciences, San Jose, CA, USA); P35 (1:1000), cyclin-dependent kinase 5 regulator 1 (CDK5R1; 1:1000), P-CDK5 (1:1000), CDK5 (1:1000), P-PKCɛ (1:1000), and PRDX3 (1:1000) (Santa Cruz, Dallas, TX, USA); NAMPT (1:1000) ALDH2 (1:1000) (Proteintech, Rosemont, IL, USA); and ALDH2 (1:1000), P-p66Shc (1:1000) 4HNE (1:2000) and ACTIN (1:5000) (Abcam, Cambridge, UK). Membranes were then treated with HRP-conjugated secondary antibodies. ECL reagents (ECL Plus; Amersham, GE Healthcare Life Sciences, Little Chalfont, Buckinghamshire, UK) were used to identify immunoreactive proteins. An anti-acetyl Lysine antibody was used to co-immunoprecipitate the cell protein lysates.
+ Open protocol
+ Expand
5

Molecular Profiling of Liver Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Liver tissues and PMH were processed using RT-PCR and Western blot analysis as we previously described [24 (link)]. The relative expression levels of mRNA and protein for a target gene were normalized to relative changes with β-actin. The primers used for RT-PCR analysis are as follows:

MCP1: F GGGCCTGCTGTTCACAGTT

MCP1: R CCAGCCTACTCATTGGGAT

IL-6: F TAGTCCTTCCTACCCCAATTTCC

IL-6: R TTGGTCCTTAGCCACTCCTTC

TNF-α: F CCCTCACACTCAGATCATCTTCT

TNF-α: R GCTACGACGTGGGCTACAG

IL-1β: F TGGACCTTCCAGGATGAGGACA

IL-1β: R GTTCATCTCGGAGCCTGTAGTG

β-Actin: F TGACAGGATGCAGAAGGAGA

β-Actin: R ACCGATCCACACAGAGTACT

The primary antibodies against P62 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), cleaved caspase-3 (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bax (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bcl2 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), 4HNE (rabbit polyclonal, 1 : 1000, Abcam), ALDH2 (rabbit polyclonal, 1 : 3000, Proteintech), LC3B (rabbit polyclonal, 1 : 1000, Proteintech), and β-actin (1 : 20000, Sigma-Aldrich) were used.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!