The species identification PCR reaction contained 10 µL of SsoFast™ EvaGreen® Supermix (Bio-Rad Laboratories Incorporated, Hercules, California, USA), 1 µL of 10 µM of each primer (see rnl real-time PCR), 6 µL of ultrapure water, and 2 µL of each DNA sample (20.0 ng/reaction). All samples were run in duplicate with three biological replicates and with positive controls for each species or species complex (R. arrhizus, R. microsporus, M. circinelloides, and Lichtheimia species complexes; AS119, F50, AS84 and FF18, respectively, Table S2 ). Sterile water (B. Braun, Germany) was used as NTC. The qPCR reactions used a CFX96™ real-time PCR detection system (Bio-Rad Laboratories Incorporated, Hercules, California, USA) under the following conditions: 98.0 °C/2 min, followed by 40 cycles of 98.0 °C/5 s and 61.8 °C/10 s. After denaturation at 98.0 °C/3 s and cooling at 70.0 °C/30 s, a melt curve was generated from 72.0 °C to 81.0 °C with 0.1 °C increments/5 s dwell time. Melt curves were processed and analyzed using Precision Melt Analysis™ software (Bio-Rad Laboratories Incorporated, Hercules, California, USA) to determine average melting temperatures (Tm) and to assign samples to predefined species-specific or species-complex-specific melt profiles.
Precision melt analysis software
Manufactured by Bio-Rad
Sourced in United States
Precision Melt Analysis software is a tool used for the analysis of melting curve data generated from real-time PCR experiments. It provides automated analysis of melting curve data, including the identification of distinct melting peaks and the calculation of melting temperatures.
Automatically generated - may contain errors
Lab products found in correlation
Precision melt supermix, by Bio-Rad (10 mentions)
Ssofast evagreen supermix, by Bio-Rad (10 mentions)
Cfx96 real time pcr system, by Bio-Rad (7 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (6 mentions)
Cfx96, by Bio-Rad (4 mentions)
Qiaamp dna blood mini kit, by Qiagen (3 mentions)
Cfx96 real time pcr machine, by Bio-Rad (3 mentions)
Cfx96 real time system, by Bio-Rad (3 mentions)
Cfx96 thermocycler, by Bio-Rad (2 mentions)
Eva green dye, by Avantor (2 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
Cfx manager, by Bio-Rad (2 mentions)
Cfx384 touch real time pcr detection system, by Bio-Rad (2 mentions)
Cfx manager software, by Bio-Rad (2 mentions)
Gelred, by Biotium (2 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions)
C1000 touch thermal cycler, by Bio-Rad (2 mentions)
Precision melt supermix for hrm analysis, by Bio-Rad (2 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (2 mentions)
56 protocols using precision melt analysis software
1
Rapid Fungal Species Identification via qPCR
2
Analyzing Genetic Modifications Using HRM
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High-resolution melting (HRM) analyses were performed on PCR clones of undigested DNA from T2 seedlings of wild-type lines Cas9-CRU #2 and Cas9-PPO #7 using Precision Melt Supermix (Bio-Rad), containing EvaGreen saturated dye, and the Bio-Rad C1000 Touch thermal cycler (Bio-Rad). Melt curves were analyzed using the Bio-Rad Precision Melt Analysis software. For the CRU target primers SP492 and SP563 were used and for the PPO target primers SP560 and SP561 (Table S2 ). Samples with various melt curves were sequenced by Macrogen Europe (Amsterdam, The Netherlands).
3
Genotyping by High-Resolution Melting Curve
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from leukocytes using the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany). Genotyping was performed using high-resolution melting curve analysis [36 (link)]. Polymerase chain reaction (PCR) was performed in a 20-μL reaction mixture and a 96-well CFX96 Real-Time PCR System (BioRad Laboratories, Hercules, CA, USA). The reaction mixture consisted of 2 μL genomic DNA (template), 200 mM of primer HTR2A[rs6311], forward primer (5’-TTA GGC TGA AGG GTG AAG A-3’), reverse primer (5’-CAC TCT GGA CAC AAA CAC T-3’), SsoFast EvaGreen Supermix (1×final concentration; BioRad Laboratories, Inc.), and sterile H2O. The amplification protocol starts with an initial denaturation step at 98°C for 3 min, followed by 39 cycles of denaturation at 98°C for 10 s and 58°C for 20 s. After an initial step at 95°C for 10 s and 65°C for 10 s, melting curves were generated from 65°C to 95°C, in increments of 0.2°C at each cycle. Melting profiles were analyzed using Precision Melt Analysis software (BioRad Laboratories, Hercules, CA, USA).
4
Thyroid Cancer Genetic Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor and adjacent healthy thyroid tissue from 40 patients were tested for BRAF exon 15p.V600E mutation and KRAS (rs112445441) mutation by high-resolution melt analysis. We utilized the primers used previously by Gonzalez-Bosquet Jesus et al. [55 (link)]. Thermocycling and melting conditions were optimized for CFX96 instrument, and Bio-Rad Precision Melt Analysis software was used to identify BRAF positivity by differential melting curve characteristics.
5
High-Resolution Melt Curve Analysis of egfra and erbb2 Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High-resolution melt curve analysis was used to determine the rate of egfra and erbb2 mutation in larvae at two dpf. Genomic DNA was collected from individual larvae in both the control and experimental groups, by adding 90 μL 50 mM NaOH to each larvae in a 96-well qPCR plate and incubating at 95°C for 20 min. 10 μL Tris-HCl (pH 8) was then added as a buffer. Master mixes containing either egfra or erbb2 primers (Integrated DNA Technologies) (sequences in table below) were made up, with each well containing: 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 5 μL 2X DyNAmo Flash SYBR Green (Thermo Scientific), 3 μL milliQ water. One μL genomic DNA was added to each master mix in a 96-well qPCR plate. Melt curve analysis was performed and analysed with Bio-Rad Precision Melt Analysis software. Mutation rate was calculated by determining the percentage of egfra erbb2 larvae that showed a different melt-curve profile to the genomic DNA collected from tyrosinase fish (based on 95% confidence intervals). The average mutation rate in our experiments was 97.5% and 87.9% for egfra and erbb2, respectively.
Primer sequences used for high-resolution melt curve analysis.
Primer sequences used for high-resolution melt curve analysis.
| Gene | Forward primer sequence | Reverse primer sequence | Product size |
|---|---|---|---|
| egfra | 100 | ||
| erbb2 | 93 |
6
DNA Extraction and Genotyping of HOS1 Alleles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction from leaves was performed using the cetyl trimethylammonium bromide (CTAB) protocol (Molecular Cloning, 3rd edition). Gene-specific primer pairs HOS1-1-target and HOS1-2-target (Supplementary Table S1 ) were used to amplify 381- and 372-bp long genomic regions containing the corresponding target sites, respectively. Obtained amplicons were ligated into a pJET (Thermo Fisher Scientific Inc., MA, USA) and sequenced using an ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
To genotype mutations by a heteroduplex mobility assay (HMA), polyacrylamide gel electrophoresis (PAGE) analysis of amplicons subjected to denaturation/renaturation cycle was performed following the procedure of Reference [45 (link)]. To screen for mutations using high-resolution melting (HRM) analysis, we performed polymerase chain reaction (PCR)-HRM reactions with the same primer sets and 2.5 x SYBR green PCR master mix (Evrogen, Moscow, Russia) using CFX96 thermocycler (Bio-Rad Laboratories). Melting curves were determined by incubating the reaction mixes from 60 °C to 95 °C with an increment 0.2 °C for 10 s with a plate reading. Precision Melt Analysis software (Bio-Rad Laboratories) was utilized to discriminate between native and mutant HOS1 alleles.
To genotype mutations by a heteroduplex mobility assay (HMA), polyacrylamide gel electrophoresis (PAGE) analysis of amplicons subjected to denaturation/renaturation cycle was performed following the procedure of Reference [45 (link)]. To screen for mutations using high-resolution melting (HRM) analysis, we performed polymerase chain reaction (PCR)-HRM reactions with the same primer sets and 2.5 x SYBR green PCR master mix (Evrogen, Moscow, Russia) using CFX96 thermocycler (Bio-Rad Laboratories). Melting curves were determined by incubating the reaction mixes from 60 °C to 95 °C with an increment 0.2 °C for 10 s with a plate reading. Precision Melt Analysis software (Bio-Rad Laboratories) was utilized to discriminate between native and mutant HOS1 alleles.
7
TALEN-mediated Spo11 Knockout Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spo11 mutants were generated using TALENs targeting the second exon of spo11. The TALENs were assembled and injected as previously described [97 (link)]. The TALEN sequences were: HD-NG-NI-NI-NI-NN-NN-NG-NN-NI-NI-NN-HD-NI-HD-half repeat HD, and NG-HD-HD-NI-NN-HD-NI-NN-NN-NI-NG-HD-NG-NI-NG-half repeat NG. Injected founder fish were raised to adulthood and outcrossed to wild type fish; the resulting offspring were screened for mutations in spo11 via high resolution melt (HRM) analysis and subsequent sequencing. HRM primer sequences are: fwd TCACAGCCAGGATGTTTTGA, and rev CACCTGACATTGTTCCAGCA. The HRM analysis was performed with either Light Scanner Master Mix (BioFire Defence, Murray, UT, Catalog# HRLS-ASY-0003), 10X LCGreen Plus+ Melting Dye (Biofire Defence, Catalog# BCHM-ASY-0005), or 20X Eva Green dye (VWR, Radnor, PA, Catalog# 89138–982) using a CFX-96 real-time PCR machine and Precision Melt Analysis software (BioRad, Hercules, CA). The data presented in this paper is from individuals of a population with an 11 bp deletion mutation in exon 2 that has been outcrossed 2–3 times.
8
Genetic Variants Analysis in Immune Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty‐one genetic variants in the MBL2, FCN2, MASP2, TLR2, TLR4 and NOD2 genes with known functional implications on protein level were evaluated.17 , 18 , 19 , 20 Genomic DNA was extracted from 10 mL EDTA peripheral blood samples. Genotype identification was performed at the Leiden University Medical Centre, Leiden, The Netherlands. All genotypes were analysed using High‐Resolution Melting Analysis (HRMA) with oligonucleotide primers, deoxyribonucleotide triphosphates (dNTPs), polymerase chain reaction (PCR) buffer FS‐Taq Polymerase and specific probe in the presence of fluorochrome LC‐green Plus. Detailed description of genotyping and assessment has been published previously.17 , 18 DNA fragments were visualized using a Idaho Technology Lightscanner. HRMA genotyping of NOD2 was not conclusive (data not shown), therefore it was performed with Biorad Realtime thermal cycler CFX96 with Precision Melt Analysis Software with oligonucleotide primers (Table S1 ) in the presence of SsoFast EvaGreen Supermix. All found genetic variants were validated by DNA sequencing. The investigators were blinded for clinical outcomes during genotype determination. European cohort minor allele frequencies of the 1000 Genome Project were used as reference of genetic variation.21
9
Methylation Analysis of XAF1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation-sensitive (MS) high-resolution melt (HRM) analysis was performed as described [37 (link)]. 20 ng bisulfite converted DNA were amplified in duplicates by qPCR using a CFX96 Real-Time PCR Detection System (Bio-Rad). Primers were designed to amplify a 86 bp fragment containing 3 CpGs from -236 to -196 upstream of the XAF1 transcription start site (forward 5′-GGTTGTTAGTTTTAGGGAGGTAGA-3′; reverse 5′-TAGTAGGGGTTGGTTATGTTGT-3′). Melting data were analyzed and normalized using the Precision Melt Analysis Software (Bio-Rad). For sample interpolation, DNA standards with defined overall methylation value (Supplementary Figure 4B ) were analyzed in every assay. The area under the curve (AUC) of the normalized melt curves was used to calculate a linear regression model (Supplementary Figure 4C ) for the methylation standards (Prism 6.0c for Mac). % methylation was interpolated from the standard curve.
10
High-Resolution Melt Analysis of Genotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotypes of the NFX1 and PYC genes located at both ends of contig 1135 of the IPO94269 genome sequence were determined on the progeny strains by HRM analysis in comparison to the parental strains. The primer pairs NFX1_11422FW/NFX1_11422RV and PYC_5UTR_FW/PYC_5UTR_RV (Table S2 ), showing close to 100% amplification efficiency on serial DNA dilutions of the parental strains, were used for HRM comparisons under the following conditions. In a total volume of 25 µl, 5 ng of genomic DNA was analyzed with 300 nM both primers using 1× SsoFast Evagreen Supermix (Bio-Rad, Marnes-la-Coquette, France). The cycling parameters were 98°C for 2 min followed by 40 cycles of 98°C for 2 s and 60°C for 5 s. The high-resolution melt curve was established between 70 and 95°C with 0.2°C increments every 10 s in a CFX-96 real-time PCR system (Bio-Rad). Melting curve normalization and differentiation were performed using Precision Melt Analysis software (Bio-Rad).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!