3 mercaptopropyl trimethoxysilane

Manufactured by Merck Group

Sourced in United States, France, United Kingdom, Germany, Denmark

(3-mercaptopropyl)trimethoxysilane is a chemical compound used in the production of various lab equipment and materials. It is a silane-based coupling agent that is commonly used to modify the surface properties of materials. The compound contains a mercapto group (-SH) and three methoxy groups (-OCH3), which can interact with and bind to different substrates.

Automatically generated - may contain errors

Lab products found in correlation

Tetraethyl orthosilicate, by Merck Group (12 mentions) Silver nitrate, by Merck Group (10 mentions) Sodium hydroxide (naoh), by Merck Group (9 mentions) Cetyltrimethylammonium bromide, by Merck Group (8 mentions) Ethanol, by Merck Group (7 mentions) Toluene, by Merck Group (7 mentions) Sodium borohydride, by Merck Group (6 mentions) Hydrochloric acid (hcl), by Merck Group (6 mentions) 1 octadecene, by Merck Group (6 mentions) Bovine serum albumin (bsa), by Merck Group (6 mentions) Sulfuric acid, by Merck Group (5 mentions) L ascorbic acid, by Merck Group (5 mentions) Oleic acid, by Merck Group (5 mentions) Hydrogen peroxide, by Merck Group (5 mentions) 3 aminopropyltrimethoxysilane, by Merck Group (4 mentions) Ammonium hydroxide, by Merck Group (4 mentions) 3 aminopropyltriethoxysilane, by Merck Group (4 mentions) Pluronic f 127, by Merck Group (4 mentions) Dimethyl sulfoxide (dmso), by Merck Group (4 mentions) Trypsin edta, by Thermo Fisher Scientific (4 mentions)

Spelling variants of this product

(3-mercaptopropyl)trimethoxysilane (MPTMS, (14 citations) Trimethoxysilane (11 citations) 3-mercaptopropyl-trimethoxysilane (MTS), (2 citations) (3-Mercaptopropyl) trimethoxysilane (3-MPS), 4-Maleimidobutyric acid N-hydroxysuccinimide ester (GMBS), polyvinylpyrrolidone (PVP, MW~40,000), anhydrous ethanol (2 citations) 3-Mercaptopropyl trimethoxysilane (3-MPTS) (2 citations)

66 protocols using 3 mercaptopropyl trimethoxysilane

Synthesis and Characterization of Functionalized Gold Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chloro(triphenylphosphine)gold(I) (≥99.9% trace metals basis, Aldrich), 1-Octanethiol (≥98.5%, Aldrich), 3-Mercaptopropionic acid (HPLC, ≥99.0%, Aldrich), 3-Mercaptopropionic-2,2,3,3-d4 Acid (98 atom % D, C/D/N Isotopes Inc.), borane t-butylamine complex (97%, Aldrich), Acetone(HPLC, ≥99.8%, Aldrich), M Ethanol (HPLC, ≥99.9%, Aldrich), Ethanol (HPLC, ≥99.8%, Aldrich), Chloroform (HPLC, ≥99.9%, Aldrich), Toluene (HPLC, 99.8%, Aldrich), Sulfuric acid (98.0%, Aldrich), (3-Mercaptopropyl)trimethoxysilane (95%, Aldrich), Hexane (99%, Aldrich), Iodine (≥99.99% trace metals basis, Aldrich), Tetrahydrofuran-d8 (≥99.5 atom % D, Aldrich), Chloroform-d (99.8 atom % D, Aldrich), M Ethanol-d4 (99.96 atom % D, Aldrich). All chemicals were used as received.

Luo Z., Murello A., Wilkins D.M., Kovacik F., Kohlbrecher J., Radulescu A., Okur H.I., Ong Q.K., Roke S., Ceriotti M, & Stellacci F. (2019). Determination and evaluation of the nonadditivity in wetting of molecularly heterogeneous surfaces. Proceedings of the National Academy of Sciences of the United States of America, 116(51), 25516-25523.

+ Open protocol

+ Expand

Multifunctional Nanoparticles for Targeted Drug Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chemicals tetraethyl orthosilicate (TEOS), n-cetyltrimethylammonium bromide (CTAB), sodium hydroxide (NaOH), safranin O, glutathione (GSH), (3-mercaptopropyl) trimethoxysilane (MPTMS), 2,2′-dipyridyl disulfide, peroxidase from horseradish (HRP), H₂O₂ 30%, β-glycerophosphate, and poly(ethylene glycol) methyl ether thiol (Mn 800) were provided by Aldrich. Doxorubicin hydrochloride (DOX) was supplied by Sequoia Research Products. For cell culture studies, U271 malignant glioma cells, Eagle’s minimum essential medium (MEM), penicillin–streptomycin, phosphate-buffered saline (PBS), fetal bovine serum (FBS), glutamine, trypsin, and cell proliferation reagent (WST-1) were obtained from Sigma-Aldrich. Tyramine-derivatized hyaluronic acid was purchased from Contipro A.S. Ultra-pure chitosan (UP CL214, Protasan) was supplied from Pronova Biomedical (Norway). The analytical-grade solvents were provided from Scharlab (Barcelona, Spain). All reagents were used as received.

de la Torre C., Coll C., Ultimo A., Sancenón F., Martínez-Máñez R, & Ruiz-Hernández E. (2023). In Situ-Forming Gels Loaded with Stimuli-Responsive Gated Mesoporous Silica Nanoparticles for Local Sustained Drug Delivery. Pharmaceutics, 15(4), 1071.

+ Open protocol

+ Expand

Silica Wafer Surface Modification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Silica
wafers (2.0 cm × 2.0 cm) were
treated in a mixture of H₂SO₄ and 30% H₂O₂ (volumetric ratio = 7:3) for 30 min, rinsed
with deionized water, and
dried under nitrogen gas (N₂) flow. The N-Isopropylacrylamide (NIPAAm) monomer was purchased from J&K
Chemical, N,N,N′,N″,N″-pentamethyldiethylenetriamine
(PMDETA) was purchased from TCI. Trichloro(octyl)silane (TCOS), octadecyltrichlorosilane
(OTCS), 3-aminopropyl trimethoxysilane (APTMS), 3-mercaptopropyl trimethoxysilane
(MPTMS), trichloro(1H,1H,2H,2H-perfluorooctyl) silane (PFS), 2-bromoisobutyryl
bromide, and copper(I) chloride (CuCl) were provided by Aldrich. The
polystyrene microparticles with a diameter of 620 nm were provided
by Wuhan Sphere Scientific Co., Ltd. and were cleaned with water and
50% ethanol several times before use. Dichloromethane, absolute ethanol,
triethylamine, sodium dodecyl sulfate (SDS), methanol, 1,2-dichloroethane,
and the four components of the photoresist were used directly after
received. The masks employed for photolithography were machined by
the Institute of Microelectronics of Chinese Academy of Sciences.
The TJ-1A-Micro Flow syringe pump was purchased from Baoding Longer
Precision Pump Co., Ltd. The water in all experiments was deionized
and doubly distilled prior to use.

Liu W., Xiang S., Liu X, & Yang B. (2020). Underwater Superoleophobic Surface Based on Silica Hierarchical Cylinder Arrays with a Low Aspect Ratio. ACS Nano, 14(7), 9166-9175.

+ Open protocol

+ Expand

Synthesis and Characterization of Gold Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gold chloride (HAuCl₄, 99%), sodium borohydride (NaBH₄, 99%), cetyltrimethylammonium bromide (CTAB), sodium oleate (NaOL, > 97%), l-ascorbic acid (AA), silver nitrate (AgNO₃, 99%), hydrochloric acid (HCl, 95−98%), (3-mercaptopropyl)trimethoxysilane (MPTMS), and sodium chloride (NaCl) were purchased from Sigma-Aldrich (St. Louis, MO). Tris(2-carboxyethyl)phosphine (TCEP) was from Thermo Scientific (Rochester, NY). All the following DNA oligonucleotides were synthesized and HPLC-purified by Biosearch Technologies (Petaluma, CA). Single-strand DNA (ssDNA) sequences include thiolated 5′-SS-C6- TTTTAGAGATATGAGCAG-3′; 5′-SS-C6- TTTTAGAGATATGAGCAGAACTGGAAAGGAGGCTGAGAGATGGCT-3′; and 5′-SS-C6- TTTTAGAGATATGAGCAGAACTGGAAAGGAGGCTGAGAGATGGCTCGAGTACTACCAGGCTGCGACTCGTCAGACGTATAGTGA-3′. Fluorescence-labeled complementary ssDNA sequences: 5′-Quasar 670-CTGCTCATATCTCTAAAA-3′; 5′-Quasar 670- AGCCATCTCTCAGCCTCCTTTCCAGTTCTGCTCATATCTCTAAAA-3′; and 5′-Quasar 670- TCACTATACGTCTGACGAGTCGCAGCCTGGTAGTACTCGAGCCATCTC-TCAGCCTCCTTTCCAGTTCTGCTCATATCTCTAAAA-3′; Hairpin probe ssDNA is 5′-SS-C6-TTTTTTTTTCGACGAGAGATATGAGCAGAACTGGAAAGGAGGC-TGACGTCG-Quasar 670−3′, whereas the detection ssDNA is 5′-TCAGCCTCCTTTCCAGTTCTGCTCATATCTCT-3′.

Mei Z, & Tang L. (2016). Surface-Plasmon-Coupled Fluorescence Enhancement Based on Ordered Gold Nanorod Array Biochip for Ultrasensitive DNA Analysis. Analytical chemistry, 89(1), 633-639.

+ Open protocol

+ Expand

Synthesis of Gold Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chemicals were obtained from Sigma Aldrich, including hexadecyltrimethylammonium bromide (CTAB, ≥98%), hydrogen tetrachloroaurate trihydrate (HAuCl₄·3H₂O), l-ascorbic acid, silver nitrate (AgNO₃), sodium borohydride (NaBH₄), hydrochloric acid (HCl, 37 wt% in water), 3-mercaptopropyltrimethoxysilane (MPTMS), sodium silicate solution, tetraethyl orthosilicate (TEOS), sodium hydroxide (NaOH), and potassium iodide (KI). Other chemicals obtained from additional suppliers were sodium oleate (NaOL, TCI), nitric acid (HNO₃, 70%, Merck), ethanol (analytical pure, Solveco) and iodine (I₂, VWR Chemicals).

Chen Y., Lerch S., Say Z., Tiburski C., Langhammer C, & Moth-Poulsen K. (2021). Catalytically active and thermally stable core–shell gold–silica nanorods for CO oxidation. RSC Advances, 11(19), 11642-11650.

+ Open protocol

+ Expand

PCR-based AuNP-Probe Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reagents included dNTPs (SBS Genetech Co., Ltd., Shanghai, China), GoTaq Hot Start polymerase (Promega, Beijing, China), PEG8000(BSK Technology Co., Ltd., Nanjing China) and mineral oil (Sigma‐Aldrich, St. Louis, MO). Tris, MgCl₂·6H₂O, and NaCl were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Nonidet P‐40 and Tween‐20 were obtained from Amresco. A 10× reaction buffer (10× IB buffer) containing 100 mM Tris−HCl (pH 8.5), 300 mM NaCl, 75 mM MgCl₂, 0.5% Nonidet P‐40, and 0.5% Tween‐20 was prepared in our laboratory. Reagents of gold nanoparticle probes (AuNP‐probes) preparation included (3‐Mercaptopropyl)‐trimethoxy silane (Sigma‐Aldrich LLC), Chloroauric acid tetrahydrate (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China), and sodium citrate (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China). Flap endonuclease 1 (FEN1) and AuNP‐probes were prepared in our laboratory as published procedure [27 (link), 28 (link), 29 (link)]. Lysis solution for oral swabs included Lysis Buffer (Yaneng bio, Shenzhen China), QuickExtract™ (Lucigen, Beijing China) and Tris‐HCl Buffer containing 67 mM Tris‐HCl. Equipment included a PCR machine (A200 Gradient Thermal Cycler, Long Gene) and One Drop OD‐1000 (Wuyi Technology Co., Ltd., Nanjing, China).

Li Y., Wei W., Ma Y., Shan J., Chu Y., Zhang L., Liu D., Ma X., Zhou G, & Wu H. (2023). Visualised genotyping assay with oral swabs in a closed tube by nested invasive reaction assisted with gold nanoparticle probes. IET Nanobiotechnology, 17(3), 281-288.

+ Open protocol

+ Expand

Hydrogel Synthesis from PEG and Dextran

Check if the same lab product or an alternative is used in the 5 most similar protocols

4-arm 20 kDa poly(ethylene glycol)-amine
was purchased from JenKem Technology USA (SKU: 4ARM-NH2Cl). 40 kDa
Dextran (40 kDa) was purchased from Thermo Scientific (formerly manufactured
by Alfa Aesar, Catalog number: J63690.18). Lithium phenyl-2,4,6-trimethylbenzoylphosphinate
(lithium acyl phosphinate, LAP) was purchased from Sigma-Aldrich (CAS:
85073-19-4). KCGPQGIAGQCK and CGRGDS peptides were custom-ordered
from AAPPTec. (3-Mercaptopropyl)trimethoxysilane was purchased from
Sigma-Aldrich (CAS: 4420-74-0). 4-arm 20 kDa poly(ethylene glycol)-thiol
(PEG-SH) was purchased from Laysan Bio, Inc. (Item number: 4arm-PEG-SH-20K-1g).
All materials were used as received unless otherwise specified.

Tigner T.J., Scull G., Brown A.C, & Alge D.L. (2023). Microparticle Hydrogel Material Properties Emerge from Mixing-Induced Homogenization in a Poly(ethylene glycol) and Dextran Aqueous Two-Phase System. Macromolecules, 56(21), 8518-8528.

+ Open protocol

+ Expand

Silane-based Functionalization for Biosensors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tetraethyl orthosilicate (TEOS, 99.999%), 3-(trimethoxysilyl)-1-propanamine (APTMS, 97%), (3-mercaptopropyl)trimethoxysilane (MPTMS, 95%), TSPP (≥95.0%), TPEN (≥98.0%), ZnCl₂ (99.99%), and ammonia solution (99.99%) were supplied by Sigma-Aldrich. Ascorbic acid (99%) was purchased from J&K. SOCl₂ (99.5%), imidazole (99.5%), NaNO₂ (99%), FeCl₃ (99.9%), and chitosan (≥95% deacetylated) were obtained from Aladdin. Phosphoric acid (analytical reagent), nitric acid (analytical reagent), and cellulose paper were purchased from Wanqing Chemical (Nanjing, China). Pure water (18.2 MΩ cm⁻¹) was obtained from a Pall Cascade AN system.

Shen P., Liu Y., Qu X., Zhu M., Huang T, & Sun Q. (2023). An optical keypad lock with high resettability based on a quantum dot–porphyrin FRET nanodevice. Nanoscale Advances, 5(11), 2986-2993.

+ Open protocol

+ Expand

Synthesis of Biofunctionalized Silica Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ethanol (99.5%), Cetyltrimethyl ammonium bromide (CTAB), Tetraethyl orthosilicate (TEOS, 28%) were obtained from Tianjin Yuanli Chemical Co. Ltd. (China). Aqueous ammonia (NH₃·H₂O, 25%), (NH₄)₆Mo₇O₂₄·4H₂O and thiourea (CN₂H₄S) were obtained from Aladdin Reagent (Shanghai, China). 3-mercaptopropyltrimethoxysilane (MPTMS), Human serum albumin (HSA), 3- (4, 5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-Htetrazolium bromide (MTT), were purchased from Sigma-Aldrich (USA). Chlorine e6 (Ce6) was obtained from J&K Scientific Ltd. All chemical reagents were of analytical grade and used as received without further purification.

Yang L., Wang J., Yang S., Lu Q., Li P, & Li N. (2019). Rod-shape MSN@MoS2 Nanoplatform for FL/MSOT/CT Imaging-Guided Photothermal and Photodynamic Therapy. Theranostics, 9(14), 3992-4005.

+ Open protocol

+ Expand

Synthesis of PVA-Coated Silica Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were used in the same manner as received and were not further processed. Poly(vinyl alcohol) (PVA, 80% DA, 9–10 kDa), (3-mercaptopropyl) trimethoxysilane (MPTMS, 95%), ammonium hydroxide solution (28–30% NH₃ basis), and cetyltrimethylammonium bromide (CTAB ≥ 98%) were purchased from Sigma-Aldrich. Sodium acetate, tetraethyl orthosilicate (TEOS), sodium borohydride (NaBH₄), Au(iii) chloride hydrate (HAuCl₄), 5,5′-dithiobis (2-nitrobenzoic acid) (DTNB²⁻) and 3,3′,5,5′-tetramethylbenzidine (TMB) were purchased from Adamas. Hydrogen peroxide (30%), methanol and ethanol (analytical purity) were purchased from Chengdu Dingsheng Times Company. Deionized (DI) water (>18.2 MΩ cm) was used for all experiments.

Wang J., Ye B., Xiao S, & Liu X. (2024). Engineering a hierarchically micro-/nanostructured Si@Au-based artificial enzyme with improved accessibility of active sites for enhanced catalysis. RSC Advances, 14(4), 2697-2703.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!