Log In Sign up
The largest database of trusted experimental protocols

Quickchange mutagenesis kit

Manufactured by Agilent Technologies
Visit Supplier
Sourced in United States

The QuickChange mutagenesis kit is a molecular biology tool designed for site-directed mutagenesis. It allows users to introduce specific mutations into double-stranded plasmid DNA.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions) Pmirglo vector, by Promega (2 mentions) Gateway system, by Thermo Fisher Scientific (2 mentions) Hek flp in t rex 293 cell lines, by Thermo Fisher Scientific (2 mentions) Pgl3 vector, by Promega (2 mentions) Atto647n dope, by ATTO-TEC (2 mentions) Dual luciferase reporter assay system, by Promega (2 mentions) Dulbecco modified eagle medium (dmem), by American Type Culture Collection (1 mentions) Glutamax 1, by Thermo Fisher Scientific (1 mentions) Hek293t, by American Type Culture Collection (1 mentions) Effectene reagent, by Qiagen (1 mentions) Novagen pet21a vector, by Merck Group (1 mentions) In fusion cloning kit, by BD (1 mentions) Miniprep kit, by Qiagen (1 mentions) Egfp c1, by Takara Bio (1 mentions) Pdest15, by Thermo Fisher Scientific (1 mentions) Pkm596, by Addgene (1 mentions) Mouse monoclonal anti ha, by Santa Cruz Biotechnology (1 mentions) Endo h and pngase f, by New England Biolabs (1 mentions)

77 protocols using quickchange mutagenesis kit

1

Generation of KIF20A Mutant Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For KIF20A-529-665-K629W-S631W mutants: single-point mutations were inserted in the mouse KIF20A sequence at position 1884, 1887, and 1893 using the QuickChange mutagenesis kit (Agilent). For mCherry-KIF20A-796-887: the 2388-2661 fragment of mouse KIF20A was amplified by PCR and inserted into a mCherry vector allowing the mammalian and bacterial expression of mCherry-KIF20A-796-887. For GFP-KIF20A-25-665: the 75-1995 fragment of human KIF20A was amplified by PCR and inserted into a pOPIN-GFP vector (Addgene) allowing the mammalian expression of GFP-KIF20A-25-665. For GFP-KIF20A-25-887-K165A: single-point mutation was inserted in the mouse KIF20A sequence at position 495 using the QuickChange mutagenesis kit (Agilent).
Miserey-Lenkei S., Bousquet H., Pylypenko O., Bardin S., Dimitrov A., Bressanelli G., Bonifay R., Fraisier V., Guillou C., Bougeret C., Houdusse A., Echard A, & Goud B. (2017). Coupling fission and exit of RAB6 vesicles at Golgi hotspots through kinesin-myosin interactions. Nature Communications, 8, 1254.
+ Open protocol
+ Expand
2

Transient Transfection of Mutant TRPV2 in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human Embryonic Kidney 293T (HEK293T) cells were purchased from American Type Culture Collection (ATCC), Manassas, VA, (catalogue # CRL-3216), RRID:CVCL_0063 and tested regularly for mycoplasma contamination. Passage number of the cells was monitored, and cells were used up to passage number 25–30. The cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC, catalogue # 30–2002) supplemented with 10% (v/v) fetal bovine serum (FBS), GlutaMAX-I (Gibco, catalogue # 35050), 100 IU/ml penicillin and 100 μg/ml streptomycin and were kept in a tissue-culture incubator with 5% CO2 at 37°C. The cells were transiently transfected with cDNA encoding the rat TRPV2 (rTRPV2-WT, Leu541F-L631Phe or Val635Phe mutant), in the pcDNA3 vector and pEYFP in ratio 1:0.1 using the Effectene reagent (Qiagen) according manufacturer’s protocol and used in experiments 48–72 hr later. Point mutations were introduced using the QuickChange Mutagenesis Kit (Agilent).
Pumroy R.A., Samanta A., Liu Y., Hughes T.E., Zhao S., Yudin Y., Rohacs T., Han S, & Moiseenkova-Bell V.Y. (2019). Molecular mechanism of TRPV2 channel modulation by cannabidiol. eLife, 8, e48792.
+ Open protocol
+ Expand
3

Integrin Constructs with EGFP Tags

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The α5 with C-terminal EGFP tag (α5-EGFP) was a gift from Rick Horwitz (Addgene plasmid #15238; http://n2t.net/addgene:15238; RRID:Addgene_15238).46 (link) The α9 with C-terminal EGFP tag (α9-EGFP) was a gift from Dean Sheppard (Addgene plasmid #13600; http://n2t.net/addgene:13600; RRID:Addgene_13600). The α3, α7, and α10 integrins were cloned into pEGFP-N3 vector. The α10-N839Q mutation was generated by QuickChange mutagenesis kit (Agilent Technologies, Inc).
Zhang H., Zhu D.S, & Zhu J. (2023). Family-wide analysis of integrin structures predicted by AlphaFold2. bioRxiv.
+ Open protocol
+ Expand
4

Transfecting BRCA1 Wild-type and Mutant

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded into six-well plates or 150-mm dishes, to achieve ~60% confluency before transfection. Plasmid DNA was transfected using FuGENE 6 (Roche Diagnostics, West Sussex, UK) in a 3:1 ratio following manufacturer's instructions. The pcDNA3-HA-BRCA1 wild-type expression plasmids have previously been described45 (link) and were obtained from Dr David M Livingston (Harvard Medical School, Boston, MA, USA). The BRCA1 mutant used is the cancer-predisposing mutation C61G disrupts homodimer formation in the NH2-terminal BRCA1 RING finger domain. It was generated by site-directed mutagenesis (by Quickchange Mutagenesis kit; #200521, Agilent Technologies LDA UK Limited, Gangnam-gu, Seoul, Korea) from the BRCA1 wild-type expression vector.
Gong C., Yao S., Gomes A.R., Man E.P., Lee H.J., Gong G., Chang S., Kim S.B., Fujino K., Kim S.W., Park S.K., Lee J.W., Lee M.H., Khoo U.S, & Lam E.W. (2016). BRCA1 positively regulates FOXO3 expression by restricting FOXO3 gene methylation and epigenetic silencing through targeting EZH2 in breast cancer. Oncogenesis, 5(4), e214-.
+ Open protocol
+ Expand
5

DENV2 NS5 Recombinant Protein Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The gene encoding full-length NS5 of DENV2 was amplified by PCR from plasmid pBAC-DENV-FL DNA (kindly provided by Drs. Jose A. Usme-Ciro and Juan C. Gallego-Gomez, Universidad de Antioquia, Colombia) which contains the full length cDNA of the DENV2 NGC strain47 (link), and was cloned into the Novagen pET21a vector (EMD Millipore, Etobicoke, ON) to produce pET21aDENV2NS5FLcHis6 for expression and purification of recombinant DENV NS5 containing a carboxyl-terminus hexahistidine tag in E. coli. The amino acid substitution S600T in motif B of DENV RdRp was introduced into Dengue virus NS5 using a Quick-change mutagenesis kit (Agilent Technologies Canada Inc., Mississauga, ON).
Xu H.T., Colby-Germinario S.P., Hassounah S.A., Fogarty C., Osman N., Palanisamy N., Han Y., Oliveira M., Quan Y, & Wainberg M.A. (2017). Evaluation of Sofosbuvir (β-D-2′-deoxy-2′-α-fluoro-2′-β-C-methyluridine) as an inhibitor of Dengue virus replication#. Scientific Reports, 7, 6345.
+ Open protocol
+ Expand
6

Validating miR-466f-3p Binding to c-Met

Check if the same lab product or an alternative is used in the 5 most similar protocols
The predicted miR-466f-3p-binding sequences in c-Met 3’-UTR was amplified by PCR and inserted into pmirGLO vector (Promega, USA) to construct luciferase reporter vector (pmirGLO-c-Met-wt). Similarly, the potential binding sites of miR-466f-3p in the above sequences were mutated by Quickchange Mutagenesis Kit (Agilent Technologies, USA) to construct mutant vectors, labeled as pmirGLO-c-Met-mut. H293T cells were seeded into 12-well plates at a density of 1×105 cells/well. 24 h later, miR-466f-3p mimics or scrambles were co-transfected with recombinant wide-type or mutant vectors by Lipofectamine 3000 (Invitrogen, USA). The empty pmirGLO vector was transfected as control. The luciferase activities were standardized to the value of the co-transfected group with an empty vector and scrambles.
Li Y., Shen Z., Jiang X., Wang Y., Yang Z., Mao Y., Wu Z., Li G, & Chen H. (2022). Mouse mesenchymal stem cell-derived exosomal miR-466f-3p reverses EMT process through inhibiting AKT/GSK3β pathway via c-MET in radiation-induced lung injury. Journal of Experimental & Clinical Cancer Research : CR, 41, 128.
+ Open protocol
+ Expand
7

Engineered Aurora B GFP Fusion Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
Aurora B cDNA was a kind gift from Dr Mark Petronczski and was cloned into pcDNA5/FRT/TO (Invitrogen) engineered to express an N-terminal GFP using the InFusion cloning kit (BD) according to the manufacturer's instructions. For recombinant protein production, pET-Duet-1 Aurora B:INCENP was a gift from Dr Jon Elkins, University of Oxford. RFP-Lap2B was purchased from Addgene. Site-directed mutagenesis was completed using QuickChange mutagenesis kit (Agilent) according to the manufacturer's instructions. All clones were sequence verified.
Pike T., Brownlow N., Kjaer S., Carlton J, & Parker P.J. (2016). PKCɛ switches Aurora B specificity to exit the abscission checkpoint. Nature Communications, 7, 13853.
+ Open protocol
+ Expand
8

GGDEF and EAL Domain Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate mutations in GGDEF and EAL domains mutagenic oligonucleotides were designed (listed in Additional file 1). The QuickChange mutagenesis kit (Agilent Technologies) was used according to the manufacturer’s protocol. The resulting mutations were confirmed by DNA sequencing.
Ahmad I., Cimdins A., Beske T, & Römling U. (2017). Detailed analysis of c-di-GMP mediated regulation of csgD expression in Salmonella typhimurium. BMC Microbiology, 17, 27.
+ Open protocol
+ Expand
9

Generating ICAM-2 Variants by Overlapping PCR

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The plasmid encoding human ICAM-2 and transfectants were generated as published5 (link). Overlapping PCR using Pfu polymerase (QuickChange mutagenesis kit; Agilent Tech, Wilmington, DE, USA) and pIRES.ICAM-2 was performed to scramble 4/8 or 8/8 amino acids comprising the proposed α-actinin binding site of ICAM-2 WT (VRAAWRRL)(Figure 1). In variant mAB4, VRAAWRRL was replaced with LRAARWRV; in variant mAB8 VRAAWRRL was replaced with LARRRWAV. The sequence of plasmids encoding variants of ICAM-2 was confirmed by Sanger sequencing (St. Jude Hartwell Center, Memphis, TN, USA). In the Figures, transfected cells are referred to by the form of ICAM-2 expressed: WT, mAB4 or mAB8. Cells transfected with empty vector, SK-N-ASpIRESneo2, are labeled in the Figures as “Control”.
Feduska J.M., Aller S.G., Garcia P.L., Cramer S.L., Council L.N., van Waardenburg R.C, & Yoon K.J. (2014). ICAM-2 confers a non-metastatic phenotype in neuroblastoma cells by interaction with α-actinin. Oncogene, 34(12), 1553-1562.
+ Open protocol
+ Expand
10

Generation of P78S MMP11 Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols
A pTT3 plasmid containing the full‐length MMP11 cDNA fused to a CD4 sequence and a bioHis tag (translated at the C‐terminal end) was obtained from Addgene (#53408). The sequence of interest was cloned as a XbaI/NotI fragment into a pcDNA3.1 vector that included two copies of the FLAG tag (DYKDDDDK), followed by two STREP tags (WSHPQFEK). The P78S variant was introduced by site‐directed mutagenesis using the QuickChange mutagenesis kit (#200521, Agilent) and specific primers designed according to the cDNA sequence of the plasmid (forward: 5′‐gcacgccgcatctactaggcctcaggctgc‐3′ and reverse: 5′‐gcagcctgaggcctagtagatgcggcgtgc‐3′), following the manufacturer's instructions.
Martin‐Morales L., Manzano S., Rodrigo‐Faus M., Vicente‐Barrueco A., Lorca V., Núñez‐Moreno G., Bragado P., Porras A., Caldes T., Garre P, & Gutierrez‐Uzquiza A. (2022). Germline gain‐of‐function MMP11 variant results in an aggressive form of colorectal cancer. International Journal of Cancer, 152(2), 283-297.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!