Sybr green supermix

Manufactured by Roche

Sourced in Switzerland, United States, Australia, Canada

SYBR Green SuperMix is a ready-to-use solution for real-time PCR amplification and detection. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffer components.

Automatically generated - may contain errors

Lab products found in correlation

85 protocols using sybr green supermix

Quantitative PCR Analysis of DENV2 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

A part of extracted cDNA was measured by a Q-PCR to quantify the expression level of specific genes. Reagents prepared for Q-PCR included forward and reverse primers (2.5 μM), 10 μL SYBR green supermix (Kapa Biosystems, Wilmington, MA, USA), 4 μL cDNA template and 5.2 μL ddH₂O, making a final volume of 20 μL. The thermal cycles included 10 min of activation with AmpliTaq at 95 °C and 40 cycles of amplification consisting of 15 s for denaturation at 95 °C and 60 s for amplification at 60 °C, with an Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA). Primer pairs used in this experiment are listed as follows: 18S rRNA forward, 5′-ATTGACGGAAGGGCACCACCAG; 18S rRNA reverse, 5′-AGAACGGCCATGCACCACTACC (for the internal control); D2V2 forward, 5′-TGGACCGACAAAGACAGATTCTT; D2V2 reverse, 5′-CGYCCYTGCAGCATTCCAA (for DENV2).

Hou J.N., Chen T.H., Chiang Y.H., Peng J.Y., Yang T.H., Cheng C.C., Sofiyatun E., Chiu C.H., Chiang-Ni C, & Chen W.J. (2017). PERK Signal-Modulated Protein Translation Promotes the Survivability of Dengue 2 Virus-Infected Mosquito Cells and Extends Viral Replication. Viruses, 9(9), 262.

+ Open protocol

+ Expand

Quantifying Gene and miRNA Expression

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 200 mg tissue from LA, LV, and AA using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), following the manufacturer’s instructions [9 (link)]. cDNA synthesis for elastin quantification was performed using a first-strand cDNA synthesis kit (Roche Diagnostics GmbH, Mannheim, Germany) from 1-5 μg of total RNA; amount of total RNA was the same within the pair transcript-gene of interest. MiRNA quantification was performed from 2.5 μg of total RNA using the NCode^™ miRNA first-strand cDNA synthesis kit (Life technologies, cat #45-6612) with GoTaq® qPCR Master Mix (Promega A6002, Madison, USA) [18 (link), 45 (link)]. qPCR with 10 ng/reaction was performed on the CFX96^™ Real-Time PCR Detection System using SYBR Green supermix (Kapa Bio systems Inc. Woburn, MA, USA). Quantitative PCR was performed in duplicates with sequence-specific oligonucleotides, that were custom-synthesized [59 (link)] (Thermo Fisher Scientific Inc, Waltham, MA, USA and Invitrogen, Carlsbad, CA, USA) and also commercially available (Roche, Applied sciences, Indianapolis, IN, USA) (Table 2) [16 (link)]. Data were collected on a LightCycler^® 480 (Roche, Applied Sciences, Indianapolis, IN, USA) for ELN expression. Gene expressions were compared to suitable reference genes (i.e., β-actin, s-19, and UC6) and normalized using the 2^−ΔΔC_T method.

SCHLABRITZ – LOUTSEVITCH N., APOSTOLAKIS-KYRUS K., KRUTILINA R., HUBBARD G., KOCAK M., JANJETOVIC Z., SATHANANDAM S., SLOMINSKI A., MARI G, & DICK E J.r. (2016). PREGNANCY-DRIVEN CARDIOVASCULAR MATERNAL MIR-29 PLASTICITY IN OBESITY. Journal of medical primatology, 45(6), 297-303.

+ Open protocol

+ Expand

Real-time qPCR Assessment of Lung Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lungs were homogenized and total RNA was isolated using TRIzol Reagent (Invitrogen, Life Technologies, Australia). Random-primed reverse transcriptions were performed using BioScript reverse transcriptase in one times first-strand buffer according to the manufacturer’s instructions (Bioline Pty. Ltd., NSW, Australia). Real-time qPCR assays were performed with SYBR Green Supermix (KAPA Biosystems, Inc., MA) and a Mastercycler ep realplex2 system (Eppendorf South Pacific Pty. Ltd., NSW, Australia). IL-33 and IL-13 gene expression was normalized to the housekeeping gene hypoxanthine guanine phosphoribosyltransferase (Hprt). Hprt: forward 5′-AGGCCAGACTTTGTTGGATTTGAA-3′ ;Hprt: reverse 5′-CAACTT GCGCTCATCTTAGGCTTT-3′; Il 33: forward 5′-CCTCCCTGAGTACA TACAATGACC-3′; Il 33: reverse: 5′-GTAGTAGCACCTGGTCTTGCTC TT-3′; Il 13: forward: 5′-TGCTTGCCTTGGTGGTCT-3′; and Il 13: reverse: 5′-GGGGAGTCTGGTCTTGTGTG-3′.

Donovan C., Starkey M.R., Kim R.Y., Rana B.M., Barlow J.L., Jones B., Haw T.J., Mono Nair P., Budden K., Cameron G.J., Horvat J.C., Wark P.A., Foster P.S., McKenzie A.N, & Hansbro P.M. (2018). Roles for T/B lymphocytes and ILC2s in experimental chronic obstructive pulmonary disease. Journal of Leukocyte Biology, 105(1), 143-150.

+ Open protocol

+ Expand

Quantitative PCR gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qPCR experiments were performed using a Realplex real time PCR detection system (Eppendorf, Germany). Human specific primers (MWG-Biotech AG) used are as mentioned in Table I. Reactions were carried out using SYBR Green Super Mix (Kapa Biosystems, USA) in a final volume of 10 μl with 0.3 μM of each primer. Negative controls were used as no template cDNA reactions and melting curves were used to confirm the results. The results were normalized using GAPDH concentration of each sample.

Nandy S.B., Mohanty S., Singh M., Behari M, & Airan B. (2014). Fibroblast Growth Factor-2 alone as an efficient inducer for differentiation of human bone marrow mesenchymal stem cells into dopaminergic neurons. Journal of Biomedical Science, 21(1), 83.

+ Open protocol

+ Expand

Luteolin-Induced Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Was performed as described earlier in [6 (link)]. Briefly, following treatment with luteolin, total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was synthesized with oligo(dT) (28-mer) (Invitrogen) and Moloney murine leukemia virus reverse transcriptase (Sigma), and expression analysis was carried out using SYBR Green supermix (Kapa) and gene-specific primers.

Selvi R.B., Swaminathan A., Chatterjee S., Shanmugam M.K., Li F., Ramakrishnan G.B., Siveen K.S., Chinnathambi A., Zayed M.E., Alharbi S.A., Basha J., Bhat A., Vasudevan M., Dharmarajan A., Sethi G, & Kundu T.K. (2015). Inhibition of p300 lysine acetyltransferase activity by luteolin reduces tumor growth in head and neck squamous cell carcinoma (HNSCC) xenograft mouse model. Oncotarget, 6(41), 43806-43818.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation from cancer cells was performed using Trizol (Invitrogen). RNA was then converted into cDNA using Superscript Reverse Transcriptase (Invitrogen). Gene expression was quantified by real-time PCR using SYBR Green Supermix (KAPA Biosystems) in a real-time PCR machine (BioRad). The expression of each gene was measured in triplicate and normalized with the β-actin housekeeping gene. The ΔΔCt method was then used to quantify the gene expression of each condition with a respective calibrator as specified in each figure legend. The primers used for each target gene are shown in Supplementary Table 1.

Kalli M., Minia A., Pliaka V., Fotis C., Alexopoulos L.G, & Stylianopoulos T. (2019). Solid stress-induced migration is mediated by GDF15 through Akt pathway activation in pancreatic cancer cells. Scientific Reports, 9, 978.

+ Open protocol

+ Expand

Gene Expression Quantification by Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from both fibroblasts and cancer cells using Trizol (Invitrogen) and reverse transcribed to cDNA using Superscript Reverse Transcriptase (Invitrogen). Quantification of gene expression was performed by real-time PCR using SYBR Green Supermix (KAPA Biosystems) in a real-time PCR detection system (BioRad). The primers for the β-actin housekeeping gene were used as an internal control. Each sample was measured in triplicate for each gene. The relative quantification of gene expression was analyzed by the ΔΔCt quantification method, using a relevant calibrator as specified in each figure legend. Real-time PCR primers for target genes are listed in Supplementary Table 1.

Kalli M., Papageorgis P., Gkretsi V, & Stylianopoulos T. (2018). Solid stress facilitates fibroblasts activation to promote pancreatic cancer cell migration. Annals of biomedical engineering, 46(5), 657-669.

+ Open protocol

+ Expand

Quantifying MFG-E8 Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using TRIzol reagent (Life Technologies; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and reverse transcribed to complementary DNA (cDNA) using the PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan). For RT-qPCR, cDNA was mixed with the appropriate primers and the SYBR-Green Super mix (Kapa Biosystems, Inc., Wilmington, MA, USA) and run on the CFX96 Real-Time system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). All mRNA data were normalized to the expression of GAPDH. The primers used in the present study were as follows: Human MFG-E8 forward, 5′-GTAACTTTGGCTCTGTCC-3′ and reverse, 5′-GTTCTTCTTGTGGGAGTG-3′; human GAPDH forward, 5′-CCACTCCTCCACCTTTG-3′ and reverse, 5′-CACCACCCTGTTGCTGT-3′. The procedure for RT-qPCR included 5 min at 99°C, followed by 40 cycles of 15 sec at 94°C, 30 sec at 59°C and 45 sec at 72°C. The 2^−∆∆Cq method was used to calculate the relative expression of MGF-E8 (30 (link)).

Yang Y., Li J., Song Q., Zhu K., Yu X., Tian Y, & Zhang J. (2019). Reduction in milk fat globule-EGF factor 8 inhibits triple-negative breast cancer cell viability and migration. Oncology Letters, 17(3), 3457-3465.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Lung Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lungs were homogenized and total RNA was isolated using TRIzol Reagent (Invitrogen, Life Technologies, Australia). Random‐primed reverse transcriptions were performed using BioScript reverse transcriptase in one times first‐strand buffer according to the manufacturer's instructions (Bioline Pty. Ltd., NSW, Australia). Real‐time qPCR assays were performed with SYBR Green Supermix (KAPA Biosystems, Inc., MA) and a Mastercycler ep realplex2 system (Eppendorf South Pacific Pty. Ltd., NSW, Australia). IL‐33 and IL‐13 gene expression was normalized to the housekeeping gene hypoxanthine guanine phosphoribosyltransferase (Hprt). Hprt: forward 5′‐AGGCCAGACTTTGTTGGATTTGAA‐3′; Hprt: reverse 5′‐CAACTTGCGCTCATCTTAGGCTTT‐3′; Il 33: forward 5′‐CCTCCCTGAGTACATACAATGACC‐3′; Il 33: reverse: 5′‐GTAGTAGCACCTGGTCTTGCTCTT‐3′; Il 13: forward: 5′‐TGCTTGCCTTGGTGGTCT‐3′; and Il 13: reverse: 5′‐GGGGAGTCTGGTCTTGTGTG‐3′.

+ Open protocol

+ Expand

Analyzing Uterine Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from homogenized uterine tissue using TRIzol® Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. Concentration and purity of RNA was quantified using a NanoDrop™ 1000 Spectrophotometer (Thermo Fisher Scientific). RNA (1 µg) was treated with DNase I (Sigma-Aldrich) and reverse transcribed using BioScript™ reverse transcriptase enzyme and random hexamer primers (Bioline), according to the manufacturer’s instructions (Starkey et al, 2013 (link)). Gene expression was evaluated by real-time qPCR using custom designed primers (Table EV3; IDT) and SYBR Green Supermix (KAPA Biosystems), or TaqMan® Gene Expression Assays (mIfne: Mm00616542_s1; mHprt: Mm00446968_m1; hIfne: Hs00703565_s1; hHprt1: Hs02800695_m1; Thermo Fisher Scientific), on a Mastercycler® ep realplex2 system (Eppendorf) (Horvat et al, 2010 (link); Phipps et al, 2007 (link)). Expression levels of genes were calculated relative to the reference gene using the 2^−∆∆Ct method. Crucial qPCR data (e.g., Il15 expression in uterine tissue) was confirmed by assessing protein levels in uterine lavage fluid by ELISA (Fig. 3B).

Mayall J.R., Horvat J.C., Mangan N.E., Chevalier A., McCarthy H., Hampsey D., Donovan C., Brown A.C., Matthews A.Y., de Weerd N.A., de Geus E.D., Starkey M.R., Kim R.Y., Daly K., Goggins B.J., Keely S., Maltby S., Baldwin R., Foster P.S., Boyle M.J., Tanwar P.S., Huntington N.D., Hertzog P.J, & Hansbro P.M. (2024). Interferon-epsilon is a novel regulator of NK cell responses in the uterus. EMBO Molecular Medicine, 16(2), 267-293.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!