Kapa sybr fast qpcr kit master mix 2x abi prism

Manufactured by Roche

Sourced in United States

The KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism is a ready-to-use master mix designed for quantitative real-time PCR (qPCR) applications on the ABI Prism platform. The master mix contains all the necessary components for qPCR, including a SYBR Green I-based detection system, DNA polymerase, and buffer.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Stepone system, by Thermo Fisher Scientific (2 mentions) Rnazol rt reagent, by Molecular Research Center (1 mentions) Revertra ace qpcr rt master mix with gdna remover, by Toyobo (1 mentions) Flag tagged beads, by Merck Group (1 mentions) Pvdf membrane, by Merck Group (1 mentions) Turbofect reagent, by Thermo Fisher Scientific (1 mentions) Isopropyl β d 1 thiogalactopyranoside (iptg), by Thermo Fisher Scientific (1 mentions) Enhanced chemi luminescence (ecl), by Merck Group (1 mentions) Nocodazole, by Merck Group (1 mentions) Icrt3, by Merck Group (1 mentions) Rq1 rnase free dnase, by Promega (1 mentions) Protease inhibitor cocktail, by Merck Group (1 mentions) Phosphatase inhibitor cocktail, by Merck Group (1 mentions) Cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Hygromycin b, by Roche (1 mentions) Nucleospin rna kit, by Macherey-Nagel (1 mentions) Primescript rt reagent kit perfect real time, by Takara Bio (1 mentions) Sds 2, by Thermo Fisher Scientific (1 mentions) Dna blood mini kit, by Qiagen (1 mentions)

Spelling variants of this product

KAPA SYBR FAST qPCR Master Mix (384 citations) KAPA SYBR FAST ABI Prism qPCR Kit (25 citations) KAPA SYBR FAST qPCR Master Mix (2X) (18 citations) KAPA SYBR FAST ABI Prism 2X qPCR Master Mix (16 citations) KAPA SYBR FAST qPCR Kit Master Mix ABI Prism (10 citations) SYBR FAST ABI Prism qPCR Kit (6 citations) KAPA SYBR FAST ABI Prism qPCR Master Mix (5 citations) KAPA SYBR FAST ABI Prism kit (4 citations) KAPA SYBR® FAST Master Mix (2X) ABI Prism™ (2 citations) KAPA FAST ABI prism qPCR kit (2 citations)

7 protocols using kapa sybr fast qpcr kit master mix 2x abi prism

Quantitative RT-PCR Analysis of Adipogenic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using RNAzol RT Reagent (Molecular Research Center, Cincinnati, OH), and cDNA was synthesized from the total RNA using a ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). The procedures were performed according to the respective manufacturer’s protocols. The qPCR reactions were conducted in an Applied Biosystems StepOne system (Life Technologies) with KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism (KAPA Biosystems, Boston, MA). All samples were analyzed in triplicate and quantified by the relative standard curve method using the gene expressions of Rplp0 as an internal control. The sequences of the primer pairs used in this study are listed in Table 1.Table 1

Oligodeoxynucleotide primers used in the RT-qPCR experiments

Gene	Forward (5′-3′)	Reverse (5′-3′)
Rplp0	AGATTCGGGATATGCTGTTGGC	TCGGGTCCTAGACCAGTGTTC
Cebpa	CAAGAACAGCAACGAGTACCG	GTCACTGGTCAACTCCAGCAC
Pparg	TCGCTGATGCACTGCCTATG	GAGAGGTCCACAGAGCTGATT
Slc2a4	GTGACTGGAACACTGGTCCTA	CCAGCCACGTTGCATTGTAG
Fasn	GGAGGTGGTGATAGCCGGTAT	TGGGTAATCCATAGAGCCCAG
Adipoq	TGTTCCTCTTAATCCTGCCCA	CCAACCTGCACAAGTTCCCTT
Cebpb	AAGCTGAGCGACGAGTACAAGA	GTCAGCTCCAGCACCTTGTG
Cebpd	TTCAGCGCCTACATTGACTC	GCTTTGTGGTTGCTGTTGAAG
Cidea	ATCACAACTGGCCTGGTTACG	TACTACCCGGTGTCCATTTCT
Pgc1a	CATTTGATGCACTGACAGATGGA	GTCAGGCATGGAGGAAGGAC
Prdm16	GACATTCCAATCCCACCAGA	CACCTCTGTATCCGTCAGCA

Ando Y., Sato F., Fukunaga H., Iwasaki Y., Chiba Y., Tebakari M., Daigo Y., Kawashima J, & Kamei J. (2019). Placental extract suppresses differentiation of 3T3-L1 preadipocytes to mature adipocytes via accelerated activation of p38 MAPK during the early phase of adipogenesis. Nutrition & Metabolism, 16, 32.

+ Open protocol

+ Expand

Protein Purification and Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protease Inhibitor Cocktail, Aurora-A Inhibitor-I (AAI), nocodazole, Phosphatase Inhibitor Cocktail and Flag-tagged beads were purchased from Sigma-Aldrich. 1,4-dithiothreitol (DTT) and isopropyl β-D-1-thiogalactopyranoside (IPTG) were obtained from Acros Organics. Insect cell-expressed Aurora-A was purchased from Invitrogen. The cDNA reverse transcription kits and TurboFect reagent were purchased from Thermo Fisher Scientific. Hygromycin B and the Midi plasmid extraction kits were obtained from Roche. PVDF membrane, iCRT3 and ECL were purchased from Merck Millipore. The NTA-beads were purchased from QUIAGEN. The protein G beads for immunoprecipitation were obtained from GE. RQ1 (RNase-free DNase) was purchased from Promega. The SYBR Green reagents (the KAPA SYBR FAST qPCR kit Master Mix (2X) ABI Prism) were obtained from KAPA.

Tsai H.Y., Fu S.L., Tseng L.M., Chiu J.H, & Lin C.H. (2019). hnRNPK S379 phosphorylation participates in migration regulation of triple negative MDA-MB-231 cells. Scientific Reports, 9, 7611.

+ Open protocol

+ Expand

RT-qPCR Gene Expression Analysis

Cited 6 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from control and transfected cells using the NucleoSpin RNA kit (Macherey Nagel, Düren, Germany). cDNA was synthesized using the PrimeScript RT Reagent Kit-Perfect Real Time (Takara Bio Inc., Kusatsu, Shiga, Japan). Real-time quantitative PCR (RT-qPCR) assays were performed using the KAPA SYBR^® FAST qPCR Kit Master Mix (2X) ABI PRISM (KAPA BIOSYSTEMS, Wilmington, MA, USA) in an Applied Biosystems 96 plate system. The annealing temperature for all primer pairs was set to 60 °C. The qPCR program consisted of the following stages: an initial denaturation stage at 95 °C for 20 s, followed by 40 cycles of amplification (denaturation at 95 °C for 3 s, annealing and extension at 60 °C for 20 s) and, finally, a melt curve stage for each PCR product. All reactions were performed in triplicates. Relative expression of different gene transcripts was calculated by the ΔΔCt method. Data were normalized to GAPDH levels. The primers used for the RT-PCR analysis are listed in Table S2 in Supplementary Data [25 (link),26 (link),27 (link),28 (link),29 (link),30 (link),31 (link),32 (link),33 (link)].

Keramidas P., Papachristou E., Papi R.M., Mantsou A, & Choli-Papadopoulou T. (2023). Inhibition of PERK Kinase, an Orchestrator of the Unfolded Protein Response (UPR), Significantly Reduces Apoptosis and Inflammation of Lung Epithelial Cells Triggered by SARS-CoV-2 ORF3a Protein. Biomedicines, 11(6), 1585.

+ Open protocol

+ Expand

Measurement of Mitochondrial DNA Copy Number

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was isolated from maternal blood (28 weeks’ gestation) and cord blood samples by Qiagen DNA Blood Mini kit (Qiagen, Hilden, Germany) and diluted to 4 ng/μL. As previously described (Xu et al. 2017 (link)), mtDNAcn and single copy hemoglobin beta (HBB) gene were measured based on real-time quantitative polymerase chain reaction (PCR) and SYBR Green technology. In short, master mixes for mtDNA copy number and HBB were prepared with KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism (Kapa Biosystems, Woburn, MA, USA) and corresponding primers reported by Hou et al (Hou et al. 2010 (link)). A real-time PCR machine (7900HT, Applied Biosystems, Foster City, CA, USA) was used to perform PCR and each run included a standard curve, a control sample and a blank. For the standard curve, one reference DNA sample (from three persons) was diluted to 5 concentrations: 1, 2, 4, 8 and 16 ng/μL, The control sample was to monitor the variance between runs, and the coefficient of variation (CV) of the control sample was 5.3% based on 16 runs. All samples and standard curve points were run in triplicates. R² for each standard curve was >0.99. The relative mtDNAcn (RmtDNAcn) was calculated by SDS 2.4.1 software (Life Technologies) and indicates average mtDNAcn in each cell.

Xu Y., Wahlberg K., Love T.M., Watson G.E., Yeates A.J., Mulhern M.S., McSorley E.M., Strain J., Davidson P.W., Shamlaye C.F., Rand M.D., Myers G., van Wijngaarden E, & Broberg K. (2019). Associations of blood mercury and fatty acid concentrations with blood mitochondrial DNA copy number in the Seychelles Child Development Nutrition Study. Environment international, 124, 278-283.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using TRIzol reagent (Life Technologies, Carlsbad, CA, USA), and cDNA was synthesized from the total RNA using a PrimeScript RT reagent Kit (TaKaRa, Shiga, Japan). The procedures were performed according to the respective manufacturer’s protocols. The qPCR reactions were conducted in an Applied Biosystems StepOne system (Life Technologies) with KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism (KAPA Biosystems, Boston, MA, USA). All samples were analyzed in triplicate and quantified by the relative standard curve method using the Gapdh housekeeping gene as an internal control. The sequences of the primers used are listed in Table 1.

Ando Y., Oku T, & Tsuji T. (2016). Platelet Supernatant Suppresses LPS-Induced Nitric Oxide Production from Macrophages Accompanied by Inhibition of NF-κB Signaling and Increased Arginase-1 Expression. PLoS ONE, 11(9), e0162208.

+ Open protocol

+ Expand

Quantitative Analysis of Rad54 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the GC‐2 cells using TRIzol reagent (Invitrogen), and total RNA concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific). Reverse transcription was performed in accordance with the instruction of the first‐strand cDNA synthesis kit (Fermentas). The Table S2 shows the specific primers for Rad54 and β‐actin. qPCR was conducted on KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI PrismTM (KAPA, KR0390) as previously described.³² Relative mRNA expression was calculated using 2^−∆∆CT method.

Wang W., Peng M., Yuan H., Liu C., Zhang Y., Fang Y., Su Y., Zhang X., Zhang H., Tang Y, & Zhao K. (2021). Studying the mechanism of sperm DNA damage caused by folate deficiency. Journal of Cellular and Molecular Medicine, 26(3), 776-788.

+ Open protocol

+ Expand

RNA Isolation and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from cells or tissues was isolated using TRIzol ® reagent (Thermo Fisher Scientific) according to the manufacturer's protocol, and the concentration was quantified using Nanodrop TM 2000/2000c (Thermo Fisher Scientific). Reverse transcription was performed using ReverTraAce ® RNA (Macherey-Nagel, Düren, Germany) according to the manufacturer's protocol. Quantitative PCR was performed using the KAPA SYBR FAST qPCR Kit Master Mix (2X) ABI Prism TM (Kapa Biosystems, Boston, MA, USA) with the following primer sets: mouse Gapdh, 5'-TGT GTC CGT CGT GGA TCT GA-3' and 5'-CGT GCT TCA CCA CCT TCT TGA-3', and mouse Col1a1, 5'-GCC AAG AAG ACA TCC CTG AAG-3' and 5'-TGT GGC AGA TAC AGA TCA AGC-3'.

Ishiuchi-Sato Y, & Nedachi T. (2021). Possible involvement of CXC motif chemokine ligand 10 in exercise-induced collagen production of mouse dermal fibroblasts. Endocrine journal, 68(11).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!