Q5 real time pcr system

Total RNAs was extracted from cells and liver samples using an Omega total RNA kit, and cDNA was synthesized using the RT SuperMix for qPCR (gDNA eraser) kit (Takara Biomedical Technology, DaLian, China) according to the manufacturer’s protocol. Real-time PCR was performed using SYBR qPCR MasterMix (AG, Nanjing, China) in an Q5 Real-Time PCR System (Applied Biosystems, CA, USA) according to the manufacturer’s protocol. Gene expression levels were normalized to that of the housekeeping gene β-actin. The changes in gene expression levels were calculated using the threshold cycle (2^−ΔΔCT) method (31 (link)).

Total RNA was extracted by using TRIzol reagent (10296010, Invitrogen, Carlsbad, CA, United States) following the RNA preparation method and was quantified by using the Multiskan Go (Thermo Fisher Scientific, Wilmington, DE, United States) (Brown et al., 2018 (link)). Reverse transcription PCR was performed by using the GoScript Reverse Transcription System (A5001, Promega, Madison, WI, United States) following the instructions of the manufacturer. Quantitative real-time PCR was used to detect the messenger RNA (mRNA) expression of SOCS2 by using the iTaq^TM Universal SYBR^® Green Supermix (172-5121, Bio-Rad, Philadelphia, PA, United States). The primers were listed as follows: mSOCS2-F (5′-3′ CTC AGT CAA ACA GGA TGG TAC T); mSOCS2-R (5′-3′ TAC TCA ATC CGC AGG TTA GTC); mGAPDH-F (5′-3′ GAG CCA AAA GGG TCA TCA TCT C); and mGAPDH-R (5′-3′ GTG AGC TTC CCG TTC AGC TCT); hSOCS2-F (5′-3′) GAGCTCGGTCAGACAGGATG; hSOCS2-R (5′-3′) AGTTGGTCCAGCTGATGTTTT; hGAPDH-F: ATC GTG GAA GGA CTC ATG ACC ACA; and hGAPDH-R: AGA GGC AGG GAT GAT GTT CTG GA. Real-time PCR was performed on a Q5 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, United States). The expression of SOCS2 was calculated by comparing the threshold cycle numbers.

Total mRNA and miRNA from human leukemic cells and murine BM cells were extracted by Trizol reagent with minor modifications 30 (link). After extraction, RNA concentration and quality were determined by measuring the absorbance at 260/280 nm (DS-11 spectrophotometer, DeNovix, Wilmington, DE, USA). cDNA for qRT-PCR analysis was synthesized by using a Q5 real-time PCR system (Applied Biosystems, Carlsbad, CA, USA). miR-182 and U6 small nuclear RNA (snRNA) were reversely transcribed using Stem-loop RT primer with PrimeScript™ RT Master Mix (Takara Bio, Tokyo, Japan). U6 snRNA was used as an endogenous control for qPCR with miR-182. The special primers for miR-182 and U6 were provided by RIBOBIO company (Guangzhou, China). Human GAPDH and murine β-actin were used as endogenous controls for qRT-PCR of human and murine samples, respectively. SYBR Green dye (Takara) was used to determine the expression of mRNA and miRNA. Relative expression was calculated using the 2^-ΔΔCT method. All of the primer sequences were shown in Table S2.