Total RNA was isolated from cells using the Total RNA Kit I R6834 (Omega), and RNA was measured using the NanoDrop ND-1000 (Thermo Fisher Scientific). Purified RNA was reverse-transcribed into complementary DNA by HiScript III RT SuperMix (+gDNA wiper) (Vazyme, #R323) in accordance with the manufacturer’s instructions. The RT-qPCR reaction was performed in a Step One system using AceQ Universal SYBR qPCR Master Mix (Vazyme). Gene expression was calculated by using the comparative threshold cycle method and then normalized to the reference gene, glyceraldehyde 3-phosphate dehydrogenase. The primers used were synthesized by Sangon Biotech (Shanghai) Co Ltd.; these are listed in table S1.
Hiscript 3 rt supermix gdna wiper
Manufactured by Vazyme
Sourced in China
HiScript III RT SuperMix (+gDNA wiper) is a reverse transcription reagent designed for cDNA synthesis from RNA templates. It includes a gDNA wiper component to eliminate genomic DNA contamination.
Automatically generated - may contain errors
Lab products found in correlation
Aceq universal sybr qpcr master mix, by Vazyme (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Sybr green master mix, by Wuhan Servicebio Technology (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Nanophotometer n60, by Implen (1 mentions)
Trizol reagent, by Sangon (1 mentions)
Ethanol, by Dingguo (1 mentions)
Microelute total rna kit, by Omega Bio-Tek (1 mentions)
Mircute plus mirna first strand cdna kit, by Tiangen Biotech (1 mentions)
Mircute plus mirna qpcr kit sybr green, by Tiangen Biotech (1 mentions)
Mastercycler ep realplex2 real time pcr system, by Eppendorf (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Chamq sybr qpcr master mix, by Vazyme (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Aceq sybr green master, by Vazyme (1 mentions)
Biospin plant total rna extraction kit, by Bioer (1 mentions)
19 protocols using hiscript 3 rt supermix gdna wiper
1
RNA Isolation and RT-qPCR Analysis
2
CARD9 Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen, USA). The HiScript III RT Supermix (+gDNA wiper) (Vazyme, China) was used for mRNA reverse transcription. Real‐time PCR was performed on a LightCycler 96 System (Roche, Germany) using the SYBR Green Master Mix (Servicebio, China). The primer sequences were CARD9: F‐CAGCCCCTACATCCAGGTA and R‐CAGGGAGAAGATGGTGTTGG. CARD9 and internal reference primers were purchased from Sangon Company (China).
3
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from colon and liver tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Subsequent to the isolation, RNA integrity was assessed, ensuring that each RNA sample (1 µg) met the requisite purity and concentration criteria for further processing. Then, these samples were reverse-transcribed into complementary DNA (cDNA) using HiScript III-RT SuperMix (+gDNA wiper; Vazyme, Nanjing, China). For a qualitative assessment of gene expression, the polymerase chain reaction (PCR) was employed alongside agarose gel electrophoresis. This step provided a visual confirmation of the specific amplification and integrity of the target transcripts. The gel electrophoresis enabled the verification of the expected size of PCR products, serving as a preliminary validation of the amplification specificity and efficiency.
Advancing to quantitative analysis, quantitative PCR (qPCR) was executed on a CFX Connect real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The qPCR assay was optimized to ensure specificity, efficiency, and reproducibility, employing SYBR Green or TaqMan probes for the detection of the amplification products. Gene expression was quantified using the 2−ΔΔCt method, thus providing a relative expression level of the gene of interest. Primer sequences for qPCR are shown inSupplementary Table S2 .
Advancing to quantitative analysis, quantitative PCR (qPCR) was executed on a CFX Connect real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The qPCR assay was optimized to ensure specificity, efficiency, and reproducibility, employing SYBR Green or TaqMan probes for the detection of the amplification products. Gene expression was quantified using the 2−ΔΔCt method, thus providing a relative expression level of the gene of interest. Primer sequences for qPCR are shown in
4
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mycelia sampled at each time point were used to extract total RNA and synthesize cDNA. Total RNA was extracted using TRIzol reagent (Sangon, Shanghai, China) and other regents including chloroform, isopropyl alcohol and ethanol (Dingguo, Beijing, China) using the TRIzol method [42 (link)]. The cDNA was synthesized using 1 μg RNA as a template and purified using the HiScript III RT SuperMix + gDNA wiper (Vazyme, Nanjing, China) according to the manufacturer’s instructions. The concentration and purity of total RNA and cDNA were determined by measuring UV absorbance with the Nanophotometer® N60 (Implen, Munich, Germany).
5
Isolation and Quantification of CAF RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from CAFs and senescence-like CAFs using a MicroElute Total RNA Kit (Omega Bio-tek). At that time, the reverse transcription assay was conducted with HiScript III RT SuperMix (+gDNA wiper) (Vazyme). qPCR was performed on a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) using AceQ Universal SYBR qPCR Master Mix (Vazyme) to amplify cDNA for 40 cycles. GAPDH expression was used for normalization. The sequence of each primer is listed in Supplemental Table 3 . All primers in the study were synthesized by Sangon Biotech.
6
qRT-PCR Validation of mRNAs and miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was reverse transcribed to first-strand cDNA using HiScript III RT SuperMix (+gDNA wiper) (Vazyme, Nanjing, China). The cDNA was further used for qPCR validation of the mRNAs using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). For the qRT-PCR validation of miRNAs, the total RNA was reverse transcribed to first-strand cDNA using a miRcute Plus miRNA First-Strand cDNA Kit (Tiangen Biotech, Co., Ltd., Beijing, China). Then, the cDNA was used for qRT-PCR validation using a miRcute Plus miRNA qPCR Kit (SYBR Green) (Tiangen Biotech, Co., Ltd., Beijing, China). The qRT-PCR analysis was performed using the LightCycler96 real-time PCR system (Roach). Gene expression levels were normalized using U6 rRNA and 18s rRNA as internal controls for miRNA and mRNA, respectively. Data were generated with three biological replications. The relative expression levels of mRNAs or miRNAs were calculated using the 2−ΔΔct method. Primers used for qRT-PCR are listed in Supplementary Table S9 .
7
Quantitative PCR Analysis of Mouse Brain Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse brain tissue using TRIzol reagent (11596026, Invitrogen, USA) according to the manufacturer’s protocol. One μg of RNA was removed from each sample and reverse-transcribed into complementary DNA for qPCR using HiScript III RT SuperMix (+ gDNA wiper) (No. R323-01, Vazyme, China). A fluorescent dye ChamQ Universal SYBR qPCR Master Mix (No. Q711-02/03, Vazyme, China) was used for the reaction in Mastercycler ep Realplex2 real‐time PCR system (Eppendorf, Germany). Specific primers for qPCR were purchased from Sangon Biotech (Shanghai) Co., Ltd, as shown in Table 1 .
List of primers sequence
| Gene Name | Primer sequence (5′–3′) | Product Length |
|---|---|---|
| IL-6 | F: AAAGAGTTGTGCAATGGCAATTCT | 24 |
| R: AAGTGCATCATCGTTGTTCATACA | 24 | |
| TNF-α | F: CATCTTCTCAAAATTCGAGTGACAA | 25 |
| R: TGGGAGTAGACAAGGTACAACCC | 23 | |
| Mincle | F: ACCAAATCGCCTGCATCC | 18 |
| R: CACTTGGGAGTTTTTGAAGCATC | 23 | |
| IL-1β | F: TGCCACCTTTTGACAGTGATG | 21 |
| R: AAGGTCCACGGGAAAGACAC | 20 | |
| GAPDH | F: CGGAGTCAACGGATTTGGTCGTAT | 24 |
| R: AGCCTTCTCCATGGTGGTGAAGAC | 24 |
8
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from tissues or pre-adipocytes during differentiation by RNAiso Plus (TaKaRa, Shiga, Japan) according to accessary protocol. An HiScript III RT SuperMix + gDNA wiper (Vazyme R323-V10.1, Nanjing, China) was used to synthesize first-strand complementary DNA from equivalent amounts of RNA. Then, quantitative RT-PCR was performed with ChamQTM SYBR® qPCR Master Mix (Vazyme Q311-V9.1). Relative standard real-time PCR was performed on the Roche Light Cycler instrument. Relative gene expression was calculated by the hyperbolic method and was normalized to the expression of the housekeeping gene Rplp0 (alias 36B4). The primer sequences are listed in Table 1 and Table S1 .
9
Quantitative gene expression analysis in cotton
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from transformed fibers using the Biospin Plant Total RNA Extraction Kit (Hangzhou Bioer Technology Co., Ltd., Hangzhou, China). The cDNA was synthesized from RNA using the HiScript III RT SuperMix (+gDNA wiper) (Vazyme, Inc., China) according to the manufacturer’s instructions. Gene-specific primers for quantitative reverse transcript PCR (qRT-PCR) analysis were designed using Primer Premier 5.0 software. The qRT-PCR reaction was performed on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, United States) using AceQ SYBR Green Master (Vazyme, Inc., China). The cotton ubiquitin 7 (GhUBQ7, accession number: DQ116441 ) was used as a reference for normalization (Li et al., 2018 (link)). Relative expression levels were calculated according to the method described by Livak and Schmittgen (2001) (link). Three biological replicates were used for each sample. Detailed primer information is shown in Supplementary Table 1 .
10
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested from cells using MicroElute Total RNA Kit R6831-01 (Omega Bio-tek, Norcross, GA, USA) and reverse-transcribed into cDNA using HiScript III RT SuperMix (+ gDNA wiper) (Vazyme, Nanjing, China). The cDNA was amplified using the AceQ® Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences are shown in Supplementary Table S1 . All primers were synthesized by Sangon Biotech Co., Ltd (Shanghai).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!