Log In Sign up
The largest database of trusted experimental protocols

Shclnv

Manufactured by Merck Group
Visit Supplier

The SHCLNV is a specialized laboratory equipment designed for precise and efficient sample cleaning. It is a versatile tool that aids in the preparation of samples for various analytical procedures. The core function of the SHCLNV is to effectively remove contaminants and impurities from samples, ensuring the integrity and accuracy of subsequent analyses.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions) P9620, by Merck Group (2 mentions) Puromycin, by Merck Group (2 mentions) Shc016v, by Merck Group (2 mentions) Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (2 mentions) Rneasy plus mini kit, by Qiagen (2 mentions) Paxillin pegfp, by Addgene (1 mentions) Qrt pcr, by Thermo Fisher Scientific (1 mentions) Nanoparticle tracking analysis, by Malvern Panalytical (1 mentions) H9268, by Merck Group (1 mentions) Hexadimethrine bromide, by Merck Group (1 mentions)

6 protocols using shclnv

1

Genetic Engineering Toolkit for Cell Biology

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA against ROCK1 (SHCLNG-NM_005406.1, shROCK1: CCGGGCACCAGTTG TACCCGATTTACTCGAGTAAATCGGGTACAACTGGTGCTTTTTG), hu-CASPASE-8 (SHCLNG-NM_033356.3, shCASP-8: CCGGACATGAACCTGCTGGATATTTCTCGAGAAATATCCAGCAGGTTCATGTTTTTTG), hu-EGFR (SHCLNV NM_005228.3, shEGFR: CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGAT AGGCTTTTTTG) and a control scrambled shRNA (SHC002 MISSION pLKO.1-puri, shCTRL: CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTT GTTGTTTT) were purchased from Sigma. These shRNA were provided in the pLKO.1puro backbone for lentiviral transduction. Paxillin-pEGFP was a gift from Rick Horwitz, University of Virginia, USA (Addgene plasmid # 15233). Lentiviral pCDH-EF1a-MCS-T2A-copGFP-empty vector and WT FAK. (exo-FAK) and myristoylated FAK (myrFAK) were kindly provided by Andrew Gilmore, University of Manchester, UK. The endosomal marker mRuby-Endo-14 was a gift from Michael Davidson (Addgene plasmid # 55859).
Haun F., Neumann S., Peintner L., Wieland K., Habicht J., Schwan C., Østevold K., Koczorowska M.M., Biniossek M., Kist M., Busch H., Boerries M., Davis R.J., Maurer U., Schilling O., Aktories K, & Borner C. (2018). Identification of a novel anoikis signalling pathway using the fungal virulence factor gliotoxin. Nature Communications, 9, 3524.
+ Open protocol
+ Expand
2

Lentiviral Knockdown of Rab27a in DU145 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, DU145 cells were plated in 48-well flat-bottomed plates at 18,000 cells/well. On day one, cells were infected with lentiviral particles, at a multiplicity of infection = 10, delivering Rab27a or non-mammalian control shRNA (SHCLNV; Sigma-Aldrich) in the presence of hexadimethrine bromide (8 mg/ml, H9268; Sigma-Aldrich). Puromycin (1.25 mg/ml, P9620, Sigma-Aldrich) was added on day 2. Media were changed on day 5, and cells were cultured in the presence of Puromycin for a further six passages prior to experimental use. Rab27a expression was quantified by qRT-PCR (Applied Biosystems; Thermo Fisher Scientific), and expressed relative to the control cells. Exosome secretion was measured by nanoparticle tracking analysis (Nanosight, Malvern Instruments, Amesbury, UK) as described [15] and confirmed by immunofluorescence-based quantification of exosomes.
Salimu J., Webber J., Gurney M., Al-Taei S., Clayton A, & Tabi Z. (2017). Dominant immunosuppression of dendritic cell function by prostate-cancer-derived exosomes. Journal of Extracellular Vesicles, 6(1), 1368823.
+ Open protocol
+ Expand
3

CBX7 knockdown in PC3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC3 cells were seeded at a density of 105 (link) cells/well in a 6-well plate and allowed to adhere overnight. The media was then exchanged for 2 mL of media containing polybrene (8 μg/mL) and pre-packaged shRNA (200,000 Transducing Units/well) targeting CBX7 (Mission CBX7, SHCLNV (Sigma) TRCN0000019144RNA) or Non-targeting control (Mission pLKO.1-puro Non-Target shRNA, SHC016V (Sigma)). After 20 hours, the transduction mixture was exchanged with fresh media (GIBCO® DMEM/F12 (Ham), [+] L-Glutamine, and [+] 15 mM HEPES) and allowed to incubate for an additional 24 hours. The media was then replaced with media containing 2 μg/mL of puromycin and allowed to incubate until selection was complete as evidence by the death of all control cells that were not transduced. RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) and RNA was quantified on the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The reverse transcription reaction was performed with 500 ng RNA and the Superscript III First Strand Synthesis Supermix (Invitrogen #1172-050) according to manufacturer instructions. The resulting cDNA was diluted 1:10, and 2 μL was used for each PCR reaction. Quantitative PCR was performed using Roche FastStart Universal SYBR Green Master Mix (Rox) in a 384-well plate format on the ABI 2900HT instrument. Oligo sequences are available upon request.
Stuckey J.I., Dickson B.M., Cheng N., Liu Y., Norris J.L., Cholensky S.H., Tempel W., Qin S., Huber K.G., Sagum C., Black K., Li F., Huang X.P., Roth B.L., Baughman B.M., Senisterra G., Pattenden S.G., Vedadi M., Brown P.J., Bedford M.T., Min J., Arrowsmith C.H., James L.I, & Frye S.V. (2016). A cellular chemical probe targeting the chromodomains of Polycomb Repressive Complex 1. Nature chemical biology, 12(3), 180-187.
+ Open protocol
+ Expand
4

Lentiviral Knockdown of HuR in RAW 264.7 and BMMØs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To knockdown HuR, RAW 264.7 cells were infected with short hair-pin expressing lentiviral particle against HuR (Cat# SHCLNV, Sigma, 5 MOI, multiplicity of infection) in the presence of hexadimethrine bromide (Cat# H9268, Sigma; 8 µg/mL). After 24-hour transduction, cells resistant to puromycin (Cat# P9620, Sigma; 6 µg/mL, dose determined by titration) were further cultured. Similarly, BMMØs cultured for seven days were infected for 48 hours. HuR knockdown (HuR KD) and its effects on targets were confirmed by quantitative real-time PCR (qRT-PCR) and/or Western blotting.
Govindappa P.K., Patil M., Garikipati V.N., Verma S.K., Saheera S., Narasimhan G., Zhu W., Kishore R., Zhang J, & Krishnamurthy P. (2019). Targeting exosome-associated human antigen R attenuates fibrosis and inflammation in diabetic heart. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2238-2251.
+ Open protocol
+ Expand
5

CBX7 knockdown in PC3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC3 cells were seeded at a density of 105 (link) cells/well in a 6-well plate and allowed to adhere overnight. The media was then exchanged for 2 mL of media containing polybrene (8 μg/mL) and pre-packaged shRNA (200,000 Transducing Units/well) targeting CBX7 (Mission CBX7, SHCLNV (Sigma) TRCN0000019144RNA) or Non-targeting control (Mission pLKO.1-puro Non-Target shRNA, SHC016V (Sigma)). After 20 hours, the transduction mixture was exchanged with fresh media (GIBCO® DMEM/F12 (Ham), [+] L-Glutamine, and [+] 15 mM HEPES) and allowed to incubate for an additional 24 hours. The media was then replaced with media containing 2 μg/mL of puromycin and allowed to incubate until selection was complete as evidence by the death of all control cells that were not transduced. RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) and RNA was quantified on the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The reverse transcription reaction was performed with 500 ng RNA and the Superscript III First Strand Synthesis Supermix (Invitrogen #1172-050) according to manufacturer instructions. The resulting cDNA was diluted 1:10, and 2 μL was used for each PCR reaction. Quantitative PCR was performed using Roche FastStart Universal SYBR Green Master Mix (Rox) in a 384-well plate format on the ABI 2900HT instrument. Oligo sequences are available upon request.
Stuckey J.I., Dickson B.M., Cheng N., Liu Y., Norris J.L., Cholensky S.H., Tempel W., Qin S., Huber K.G., Sagum C., Black K., Li F., Huang X.P., Roth B.L., Baughman B.M., Senisterra G., Pattenden S.G., Vedadi M., Brown P.J., Bedford M.T., Min J., Arrowsmith C.H., James L.I, & Frye S.V. (2016). A cellular chemical probe targeting the chromodomains of Polycomb Repressive Complex 1. Nature chemical biology, 12(3), 180-187.
+ Open protocol
+ Expand
6

Stable Knockdown of m6A Writers and Erasers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus transduction particles (Mission; SHCLNV; Sigma) expressing short hairpin RNA (shRNA) and specifically targeting the m6A writer protein, METTL3 (SCHLNV NM_019852; GPP Web Portal identifier, TRCN0000289812; target sequence, CGTCAGTATCTTGGGCAAGTT), and the m6A eraser protein, FTO (SCHLNV; GenBank accession no. NM_001080432; GPP Web Portal identifier, TRCN0000246250; target sequence, TCACCAAGGAGACTGCTATTT), were used for generating stable knockdown Vero cells. Cells (60% to 70% confluent) were transduced with particles following the manufacturer’s instructions. Briefly, after 6 h of incubation, fresh medium was added with puromycin for selection, and the medium was replenished every 3 to 4 days. Individual resistant colonies were picked up and expanded. The clones were tested for knockdown of the target genes (METTL3 and FTO) using RT-qPCR and Western blot assay.
Khan O., Tanuj G.N., Choravada D.R., Rajak K.K., Chandra Sekar S., Lingaraju M.C., Dhara S.K., Gupta P.K., Mishra B.P., Dutt T., Gandham R.K, & Sajjanar B. (2023). N6-Methyladenosine RNA Modification in Host Cells Regulates Peste des Petits Ruminants Virus Replication. Microbiology Spectrum, 11(2), e02666-22.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!