The largest database of trusted experimental protocols

Direct zol rna miniprep extraction kit

Manufactured by Zymo Research
Sourced in United States

The Direct-zol RNA Miniprep extraction kit is a lab equipment product designed for the isolation and purification of total RNA from various sample types. The kit utilizes a direct-zol technology, allowing for the extraction of RNA without the need for hazardous organic solvents. The core function of this product is to provide a reliable and efficient method for the extraction of high-quality RNA.

Automatically generated - may contain errors

8 protocols using direct zol rna miniprep extraction kit

1

Quantifying lncRNA Levels via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using Direct-zol RNA Miniprep extraction kit (Zymo research, USA) and we detected the levels of lncRNAs by emplying quantitative real-time PCR (qPCR) using QuantiNova SYBR Green PCR kit (Qiagen, China), following the instructions from the manufacturer, and as described recently [10 (link)].
+ Open protocol
+ Expand
2

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For this study, total RNA was obtained from 100 mg of leaf tissue (approximately seven to nine explants) and the Direct-zol RNA MiniPrep Extraction Kit (Zymo research, R2051, Irvine, CA, USA). All steps were carried out at low temperatures to avoid RNA degradation. RNA quality was determined and quantified using a NanoDropTM 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), and the integrity was observed by 1.5% agarose gel electrophoresis. From 500 ng of total RNA, complementary DNA synthesis was carried out using the SuperScripTM First-Strand Synthesis Kit (Invitrogen, 11904018, Frederick, MD, USA). The cDNA templates for qPCR amplification were prepared from 3 individual samples from 3 independent experiments for each condition.
+ Open protocol
+ Expand
3

Brain Punch Sampling for Gene Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The processing of brains for punching was randomised by using the balls in a bag principle to prevent processing bias. A 1 mm punch (Fine Scientific Tools, 18035–01) was used to collect SON and PVN samples from 100 μm coronal slices sectioned in a cryostat set at −20 °C as previously reported [17 (link)]. Total RNA was extracted using a Directzol RNA MiniPrep extraction kit (Zymo Research).
+ Open protocol
+ Expand
4

Bilateral SON Punches for RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using the optic chiasm as a reference, a 1-mm sample corer (Fine Scientific Tools) was used to collect bilateral punches of the SON from hypothalamic coronal slices (Fine Scientific Tools). SON punches were frozen on dry ice, then re-suspended by continuous vortexing for 1 min in 400 µl of QIAzol lysis reagent (Qiagen). Following a 10-min incubation at room temperature, debris was removed by centrifugation at 12,000 × g for 3 min. The supernatant was carefully removed and then mixed with an equal volume of absolute ethanol. Total RNA was extracted with the Direct-zol RNA MiniPrep extraction kit (Zymo Research, Irvine, CA, USA) and then applied to a Zymo-Spin IIC column. RNA was eluted in a volume of 25 µl.
+ Open protocol
+ Expand
5

Isolation and Quantification of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from isolated peripheral blood leukocytes and follicular fluid samples using Direct-zol RNA Miniprep extraction kit (Zymo research, USA, Cat. No, R2050-1-50) in accordance with the manufacturer's instructions. The concentration and purity of the resultant RNA was then determined using Implen nanophotometer N50 UV–Vis spectrophotometer at 260/280 nm, so that a ratio of more than 1.8 was considered indicative of an acceptable yield and purity of RNA. Next, NEAT1, MALAT1, AR, FST and IRS-2 were reverse-transcribed using Omiscript RT kit (Qiagen, Germany, Cat. No, 205 111) using the following cycle: 60 min at 37 °C. While, miR-30a-5p and miR-30d-5p were reverse-transcribed using miRCURY LNA miRNA PCR starter kit (Qiagen, Germany, Cat. No, 339 320) using the following cycle: 60 min at 42 °C for reverse transcription, 5 min at 95 °C to inactivate the reaction. Reverse transcription reactions were carried out by Step One Real-time PCR system (Applied Biosystems, USA).
+ Open protocol
+ Expand
6

Quantitative PCR Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantative PCR was performed to verify the expression of embryonic stem cell marker mRNAs (SOX2 and KLF4). A375 cells, in both adherent and spheroid conditions, were harvested and total RNA was extracted using the Direct-zol RNA miniprep extraction kit (Zymo research, Irvine, CA), following the manufacturer’s protocol. RNA concentrations were assessed using Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA).
Specific sets of primers for SOX2 and KLF4 cDNAs were designed and synthesized (Sigma-Aldrich, Milano, Italy), according to Miranda-Lorenzo and coworkers17 (link). Real-time PCR was performed as previously described68 (link). 18 S levels were used as housekeeping controls. The amplification of gene expression was quantified using the comparative threshold-cycle (DDCt) method.
+ Open protocol
+ Expand
7

Quantifying Drosophila Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from 20 whole bodies, 20 bodies without heads, or 60 heads from 5 day old male flies (unless otherwise indicated) of the indicated genotype, using TRIzol (Life Technologies) and Direct-zol RNA MiniPrep extraction kit (Zymo Research). cDNA was generated using the iSCRIPT cDNA Synthesis kit (Bio-Rad). Quantitative real-time PCR (qPCR)-based quantification was performed for the following genes using the indicated primers:
GBA1a
Forward ACGATGACCAACGCTATTCC
Reverse ATACCAGTGCAGCGATAGCC
dGBA1b
Forward GAACCAGAGCAATCCCTTCA
Reverse TCATCGAGAGTCACGTCCAC
CG31413
Forward CAAGTCCCTTGAAGCCAGAG
Reverse CGAAGGACGAGAGGCAATAC
Rap2L
Forward CCGCTGAAGGTAATGCCTTG
Reverse CGTTTATCCGATCCTTTGCAGA
qPCR was performed using iTaq Universal SYBR Green Supermix (Bio Rad) and a LightCycler 480 (Roche) machine. The delta-delta log2 method was used to calculate fold change in expression levels. Rap2L was used as the internal control, as the expression of this gene has been reported as the most invariant across different genotypes and ages [66 (link)]. Each experiment was performed at least three times.
+ Open protocol
+ Expand
8

SARS-CoV-2 RNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Direct-zol RNA Miniprep Extraction Kit (Zymo Research, Catalog no. R2052) was used to extract the viral RNA from the collected tissues according to the manufacturer’s instructions. Genomic RNA of SARS-CoV-2 was quantified using qRT-PCR with previously described primers and probes.7 (link)
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!