All in one mirna prime script rt reagent kit

Total RNA from tissues and cells was extracted by using a TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and reverse-transcribed using All-in-One™ miRNA PrimeScript™ RT reagent kit (Takara, Shiga, Japan) and PrimeScript RT reagent kit (Takara). qRT-PCR was performed on the 7500 Fast Real-Time PCR system (Thermo Fisher Scientific) with a qRT-PCR Detection Kit (GeneCopoeia, Inc., Rockville, MD, USA) and SYBR mix (Takara). U6 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference gene. The relative expression levels of TUG1, miR-141-3p, and ROR2 were calculated by the 2^-ΔΔCt method. The sequences of primers for miR-141-3p and U6 were designed and obtained from Sangon Biotech (Shanghai, China), and sequences of primers for TUG1, miR-141-3p, ROR2, U6, and GAPDH used in qRT-PCR reactions were listed: TUG1 forward (5′-GCUUGGCUUCUAUUCUGAAUCCUUU-3′), reverse (5′-AAAGGAUUCAGAAUAGAAGCCAAGC-3′); miR-141-3p forward (5′-AAGACGTACTCAGGCCATGTCC-3′), reverse (5′-GACCCAAATGTCGCAGTCAG-3′); ROR2 forward (5′-CTTGATGGCATTGTCGCTAA-3′), reverse (5′-TCCAGTGGCTGTGCTAGATG-3′); U6 forward (5′-GCTTCGGCAGCACATATACTAAAAT-3′), reverse (5′-CGCTTCACGAATTTGCGTGTCAT-3′); and GAPDH forward (5′-GACTCATGACCACAGTCCATGC-3′), reverse (5′-AGAGGCAGGGATGATGTTCTG-3′).

Total RNA in cells was isolated using TRIzol reagent (Thermo Fisher Scientific), according to the previous description [21 (link)]. Then, All-in-One™ miRNA Prime Script™RT reagent kit (Takara, Shiga, Osaka, Japan) was used for reverse-transcription according to manufacturer’s instructions. qPCR was performed in a 20 μL total reaction volume comprised of 10 μL of SYBR Green qPCR Master Mix (2×) (Bio-Rad Laboratories, Lnc., Hercules, CA, USA), 1 μL of each gene-specific primer, 2 μL of cDNA templates, and 6 μL of PCR-grade water. Reactions were conducted on the 7500 Fast Real-Time PCR system (Thermo Fisher Scientific) in line with manufacturer’s protocol: denaturation at 94 °C for 2 min, 94 °C for 30 s, 54 °C for 30 s, 72 °C for 35 s, 30 cycles. The relative expressions were calculated by the 2^−ΔΔCt method and normalized to internal U6 small nuclear RNA (U6-snRNA, for miRNA) and GAPDH (for mRNA). The primers for miR-212-3p and U6 were purchased from Sangon Biotech (Shanghai, China). Primer sequences (5’-3’) of HMGA2 and GAPDH for qPCR were listed as follows: HMGA2-F (ATGAGCGCACGCGGTGAGGGC), HMGA2-R (GTTAGAAGACTCAAAGGAACAG), GAPDH-F (AAGCTGGTCATCAATGGGAAAC), GAPDH-R (ACCCCATTTGATGTTAGCGG).