Full-length NPMc+ was expressed as a GST (glutathione S-transferase) fusion from pGEX4T vector and purified by affinity chromatography [24] (link) using GSTrapFF column and ÄKTA Explorer (GE Healthcare). The C-terminal NPMc+ fragment corresponding to the 45 amino acids from 255 to 298 was synthesized by PCR, cloned in pETM44 vector [25] (link) as MBP (maltose binding protein)-6× His tag fusion and transformed in BL21 cells. Cultures were grown in ZYP-5052 auto-inducing medium [26] (link). Purification was performed combining HisTrapHP column and ÄKTA Explorer (GE Healthcare).
Kta explorer
Manufactured by GE Healthcare
Sourced in Sweden, United Kingdom, United States
The ÄKTA Explorer is a versatile liquid chromatography system designed for purification of biomolecules. It features automated control and monitoring of parameters such as flow rate, pressure, and UV absorbance to facilitate efficient separation and collection of target molecules.
Automatically generated - may contain errors
Lab products found in correlation
Superdex 200 10 300 gl column, by GE Healthcare (4 mentions)
Histrap hp column, by GE Healthcare (2 mentions)
Astra 6, by Wyatt Technology (2 mentions)
Dawn heleos 2, by Wyatt Technology (2 mentions)
Superose 6 column, by GE Healthcare (2 mentions)
Superdex 200 column, by GE Healthcare (2 mentions)
4800 plus maldi tof tof analyzer, by Thermo Fisher Scientific (2 mentions)
Superose 6 10 300 gl column, by GE Healthcare (2 mentions)
High molecular weight calibration kit, by GE Healthcare (2 mentions)
Quick start bradford protein assay, by Bio-Rad (2 mentions)
Avb sepharose, by GE Healthcare (1 mentions)
Optilab t rex, by Wyatt Technology (1 mentions)
10 kda centrifuge concentrators, by Merck Group (1 mentions)
Superdex 200 increase 10 300 column, by GE Healthcare (1 mentions)
Kta basic, by GE Healthcare (1 mentions)
Durapore, by Merck Group (1 mentions)
Superdex 200 10 300, by GE Healthcare (1 mentions)
Tev protease, by Merck Group (1 mentions)
Histrap hp, by GE Healthcare (1 mentions)
Superdex 200 16 60, by GE Healthcare (1 mentions)
45 protocols using kta explorer
1
Purification of NPMc+ Protein Fragments
2
Purification of ARM Lipase from E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ARM lipase expressed in TOP10 E. coli was purified by affinity chromatography technique using Äkta Explorer (GE Healthcare, Uppsala, Sweden). The harvested cell pellet was resuspended in binding buffer (20 mM sodium phosphate, 0.5 m NaCl, 20 mM imidazole, pH 7.4). The cell suspension was sonicated using a Branson Digital Sonifier (6 min with 30 s lapse; amplitude: 30%) and cleared by centrifugation (12,000× g, 30 min, 4 °C). The crude protein was loaded into 2 tandem 5 mL HisTrap HP column (GE Healthcare) at a flow rate of 1 mL/min. The column was then washed with 5 column volumes of binding buffer. Finally, the bound enzyme was eluted with elution buffer (20 mM sodium phosphate, 0.5 M NaCl, 0.5 M imidazole, pH 7.4) by a linear gradient. The protein content was determined by Quick Start™ Bradford protein assay (Biorad, Hercules, CA) and tested for lipase activity.
3
Recombinant AAV Production in Baculovirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The AAV9-PhP.B transfer plasmid was designed by adding the PhP.B peptide to VP1 between amino acids 588 and 589 of AAV9 adapted for baculovirus production. AAV5-PhP.B was constructed by swapping in the 13-mer loop containing PhP.B, as described in the study of Deverman et al. (2016) (link), and publicly available as sequence KU056473, shown in Figure 1A . Baculovirus was produced by homologous recombination with the transfer plasmids, as described earlier (Urabe et al., 2002 (link); Bosma et al., 2018 (link)). Expression cassettes containing either GFP, Luc, or miRNA were generated correspondingly. To generate AAV, Spodoptera frugiperda (SF) SF+ cells were triple-infected with baculovirus containing capsid, expression cassette, and the replicon enzyme. At 72 h postinfection, cells were lysed, and the clarified lysate was purified on the ÄKTA explorer (FPLC chromatography system, GE healthcare, United Kingdom) using AVB sepharose (GE healthcare, United Kingdom). The vectors were titrated by SYBR Green for quantitative PCR (qPCR) using a primer pair binding to the promoter region CAG (forward primer: GAG CCG CAG CCA TTG C and reverse primer: CAC AGA TTT GGG ACA AAG GAA GT) or CMV (forward primer: AATGGGCGGTAGGCGTGTA and reverse primer: AGGCGATCTGACGGTTCACTAA) and expressed as genome copies per ml (GC/ml).
4
SEC-MALLS Analysis of Mpc1/Mpc3 Complex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SEC‐MALLS analysis was performed with a Superdex 200 10/300 GL column (GE Healthcare) on an ÄKTA Explorer (GE Healthcare) coupled in line with a light scattering detector (Dawn HELEOS II, Wyatt Technologies) and a refractometer (Optilab T‐rEX, Wyatt Technologies). The Mpc1/Mpc3 complex or the individual Mpc3 protein was injected at 0.3 ml/min onto the Superdex 200 10/300 GL column equilibrated with 20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 0.005% (w/v) LMNG and 0.005 mg/ml TOCL. All data were recorded and analysed with ASTRA 6.03 (Wyatt Technologies). Molecular weight calculations were performed using the protein‐conjugate method (Slotboom et al, 2008 ) with the dn/dc value for protein of 0.185 ml/g and dn/dc value for LMNG‐TOCL of 0.1675 ml/g (Thangaratnarajah et al, 2014 ). To determine the contribution of each protein to the overall protein–detergent–lipid complex, the extinction coefficients εA280 were calculated from the amino acid sequence using the ProtParam tool on the ExPaSy server (Gasteiger et al, 2005 ).
5
Analytical SEC of Peptide Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analytical SEC was performed on an ÄKTA Explorer with a Superdex 30 analytical column (GE Healthcare) equilibrated with TDW + 0.01% DDM. Peptides were eluted with a flow rate of 0.8 ml min−1 at room temperature. Elution profile was monitored by UV absorbance at 215 nm. For the binding experiments, the peptides were incubated together in TDW + 0.01% DDM at room temperature for 2 h.
6
Purification of IgG Antibody Using NMCF-EVOH-SP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the ability of NMCF-EVOH-SP to bind and elute IgG antibody, samples were injected using a 100 μL injection loop of an ÄKTA Explorer (GE Healthcare). The flow rate throughout was 2 mL/min, with a total run time of 18 minutes. The UV absorbance was monitored at both 280 nm and 214 nm. NMCF equilibration was achieved by passing 4 CV, each of 1.54 mL, of 50 mM MES buffer, pH 5.5. The 100 µL sample loop was loaded with aggregate-containing sample and then passed through the NMCF-EVOH-SP, followed by a wash step to remove unbound protein (4 CV 50 mM MES, pH 5.5). The wash was conducted by passing MES buffer with salt within the ranges of 25 to 75 mM NaCl (8 CV). Subsequently, a step elution to remove any remaining protein using 50 mM MES buffer containing 250 mM NaCl was applied to the NMCF (4 CV). Fractions were taken throughout the process. Finally the NMCF-EVOH-SP was re-equilibrated as above. Collected fractions were used only to confirm the presence of aggregate species. These fractions were first concentrated from 3 mL to 200 µL using 10 kDa centrifuge concentrators (Millipore, Cat. No. UFC801024) and then analyzed by SEC HPLC (as described above).
7
Protein Purification Using Size Exclusion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to injection, all samples were filtered with 0.22 µm membrane filters (Durapore, Merck). All proteins in this study, except mtDod-PAS-Pep constructs, were purified by using an equilibrated Superdex 200 increase 10/300 column (GE Healthcare) on an ÄKTA Explorer or ÄKTA Basic device. For mtDod-PAS-Pep constructs, a HiLoad Superdex 200 16/600 pg was used. Running buffer for all constructs, except mtDod SpyC constructs and mtDod-msfGFP-H8, was the standard dodecin buffer. The flow rate was 0.5 mL/min for the Superdex 200 increase 10/300 column or 1.0 mL/min for the HiLoad Superdex 200 16/600 pg column with fraction resolution of 0.3 mL or 2.0 mL, respectively. The running buffer for the mtDod SpyC constructs and mtDod-msfGFP-H8 was phosphate borate buffer (as used for refolding), and the flow rate was reduced to 0.45 mL. All runs were conducted at 4 °C. Fractions were pooled and analysed by SDS-PAGE with Coomassie staining. Pooled fractions were aliquoted, frozen in liquid nitrogen and stored at − 80 °C.
8
Gel Filtration Analysis of Monomeric and Dimeric IgG
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein A purified IgG was analyzed for monomeric and dimeric IgG on a Superdex 200 10/300 gel filtration column (30 cm, 24 ml, 17-15175-01, GE Healthcare, Little Chalfont, United Kingdom) connected to an Äkta explorer (GE Healthcare) HPLC system at RT with a flow rate of 0.5 ml/min and PBS as running buffer. Elution profiles were obtained by recording the absorbance at 215 nm.
9
Purification and Characterization of Naegleria fowleri Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All proteins discussed were PCR-amplified using cDNA as a template. RNA template of Naegleria fowleri ATCC30215 was provided by Dr. Christopher Rice (University of Georgia, Athens) through RNA extraction and cDNA synthesis using previously published methodology in Acanthamoeba [56 (link)]. PCR, cloning, screening, sequencing, expression screening, large-scale expression and purification of proteins were performed as described in previous SSGCID publications [18 (link), 57 (link)]. All described constructs were cloned into a ligation-independent cloning (LIC) pET-14b derived, N-terminal His tag expression vector, pBG1861. Targets were expressed using chemically competent E.coli BL21(DE3)R3 Rosetta cells and grown in large-scale quantities in an auto-induction media [58 (link)]. All purifications were performed on an ÄKTAexplorer (GE) using automated IMAC and SEC programs in adherence to prior established procedures [18 (link)].
10
Recombinant HMGB1 Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human HMGB1 cDNA was cloned into the pETM-11 vector and expressed in Escherichia coli strain BL21 (DE3) cells. The protein expressed a 6-residue N-terminal histidine tag with a tobacco etch virus (TEV) cleavable linker and was purified by FPLC using Ni-sepharose affinity chromatography (HisTrap HP, GE Healthcare, Uppsala, Sweden) in an ÄKTA explorer (GE Healthcare). The histidine tag was cleaved using TEV protease (Sigma-Aldrich, Stockholm, Sweden) at a ratio of 1:20. Proteolytic TEV cleavage leaves a GA scar at the N-terminal. Endotoxins were removed using Triton-X114 two phase extraction. Protein purity was confirmed using SDS-PAGE gel electrophoresis analysis (21 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!