Dnase 1

DNase I footprinting assays were performed using the 6-carboxyfluorescein (FAM) labeled probe and purified LhgR. The DNA fragment F1 was PCR amplified using the primer pair F1-F/F1-R. The PCR products were cloned into the pEASY-Blunt plasmid using pEASY-Blunt Cloning Kit (TransGen, China). The FAM-labeled probes were PCR amplified using the resulting plasmid and the primer pair M13F-FAM/M13R. Then, 350 ng probes were incubated with 2 μg purified LhgR in a total volume of 40 μL for 30 min at 30 °C. The DNase I digestion reaction was carried out by adding a total volume of 10 μL solution containing approximately 0.015 units of DNase I (Promega, USA) and 100 nmol CaCl₂ and further incubating for 1 min at 37 °C, then stopped by adding a total volume of 140 μL stop solution containing 0.15% (wt/vol) SDS, 200 mM unbuffered sodium acetate, and 30 mM EDTA. The digested DNA fragments were first extracted with phenol-chloroform, then precipitated with ethanol and resuspended in 30 μL MiliQ water. The binding region of LhgR to DNA fragment F2 was analyzed using the same procedure.

DNase I footprinting assay was performed following the method described previously with minor modifications [59 (link)]. Briefly, the promoter regions of desAB in D. oryzae EC1 and B. cenocepacia H111 were amplified using the primer pairs Probe-P_desAB-F/Probe-P_desAB-R and Probe-P_desB25416-F/Probe-P_desB25416-R modified with FAM (Probe-P_desAB-F and Probe-P_desB25416-F) and HEX (Probe-P_desAB-R and Probe-P_desB25416-R) at their 5′-end to generate DNA probes. In the binding process, about 400 ng purified DNA probes were incubated with 1 μM tag-free DzrR or DzrR₂₅₄₁₆ at 25 °C for 30 min in a 40 μl binding reaction solution as described in EMSA assay. After the incubation, an aliquot of 10 μl solution with 0.03 units of DNase I (Promega, USA) was added. The samples were incubated for 1 min, and the reaction was stopped by adding the DNase I stop solution supplied by the RQ1 RNase-Free DNase kit (Promega, USA). Total DNA was purified by phenol/chloroform extraction and dissolved in 10 μl ddH₂O after ethanol precipitation. DNA samples were run on 3730XL system and the data were analyzed by Peak Scanner 2 (Applied Biosystems, USA).

Experiments were performed as previously described [35 (link)]. Essentially, the binding reactions were incubated at room temperature for 30 min before digestion in a total reaction volume of 100 μl with 0.2 units of DNaseI (Promega), 5 mM CaCl₂, 10 mM MgCl₂, and 1 μg ml^-1 salmon sperm at 37°C for 25 s. The DNaseI digestion reaction was stopped by adding 700 μl of stop solution (649 μl of absolute ethanol, 50 μl of 3 M sodium acetate, and 1 μl of 1 mg ml^-1 yeast tRNA). The digested DNA products were harvested and resuspended in Milli-Q water and the DNA fragments were analyzed on a 6% denaturing polyacrylamide gel in 1x TBE buffer. A sequence ladder was generated by using an fmol DNA sequencing system (Promega). The promoter fragments were prepared by PCR amplification using ³²P end-labeled forward primer and unlabeled reverse primer (BT3612 [5’GAAGATTTCGCCGGAGTCAA3’] and BT3613 [5’GCGTTCGGAGATATCCGGCCAG3’] for P_iscR, BT2879 [5’AACCGCTACGAGAACCTC3’] and BT3291 [5’CGAGACGAAGAGGTCGTT3’] for P_nfuA, and BT7215 [5’GACCCGGGAGTATTTCGCCA3’] and BT3590 [5’GCCTTTCTGCGGGAGCT3’] for P_tpx) and each promoter fragment as DNA template. The sequence ladder was generated using DNA promoter fragment as template.

The DNase I footprinting assay was performed as previously described (Xu et al., 2019a (link)). To precisely determine the DNA binding site of SACE_0303, 100 ng FAM/HEX-labeled P_0303–0304 was successively incubated with 0, 70, and 490 nM His6-SACE_0303 in a total 50 μL of binding buffer at 20°C for 20 min, and then 2 μL DNase I (1 U/μg; Promega) was performed at 20°C for 30 s, 10 μL DNase I stop solution was added to the mixture and reacted at 65°C for 10 min. The ethanol precipitation method was used to purify and recover DNA samples. Purified DNA was sequenced with a 3730XL DNA genetic analyzer (Applied Biosystems), and GeneMarker software program v2.2 for data analysis.

Total RNA (2 μg) was extracted from the roots of 18~20 plants exposed to low oxygen for 0, 1, 3, 8, 24, or 72 h. Residual DNA was removed by treatment with DNase I (1U/ mg RNA)(Promega, Madison, WI, USA) for 30 min at 37 °C, and then DNase I was inactivated by incubation for 5 min at 72 °C. The RNAs were reverse-transcribed with Superscript^®II Reverse transcriptase (Invitrogen, Carlsbad, CA, USA). The target cDNA was PCR-amplified in a 20 μL reaction volume containing 2 μL of 10× PCR buffer, 25 mM of each dNTP, 1 μL of cDNA, and one unit of Taq DNA polymerase (Takara, Shiga, Japan), plus 8 pmol of the appropriate primer sets (see Supplementary Table S5) in 25 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. The amplified PCR products of the target gene were evaluated by 1.5% agarose gel electrophoresis in TBE buffer stained with ethidium bromide (Sigma-Aldrich, St. Louis, MO, USA). Semi-quantitative RT-PCR was repeated with three different biological samples and the representative results were presented. Gene expression level of RT-PCR result was measured from signal intensities on photograph of an agarose gel and normalized using by an internal control such as TUB2 and Actin2. The Pearson correlation coefficients (R²) were calculated between the expression level of target genes in RT-PCR and microarray data.