Taqman fast advance master mix

Manufactured by Thermo Fisher Scientific

Sourced in United States

The TaqMan Fast Advance Master Mix is a ready-to-use reagent designed for fast and efficient real-time PCR amplification. It contains all the necessary components, including DNA polymerase, dNTPs, and buffer, to enable rapid and sensitive detection of target sequences.

Automatically generated - may contain errors

Lab products found in correlation

50 protocols using taqman fast advance master mix

Quantifying RNA Transcript Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cells using the RNeasy Mini Kit (Qiagen, Hilden, Germany). One microgram total RNA was used to generate cDNA using High-Capacity cDNA kit (Thermo Fisher). Real-time PCR was performed using 40 ng total cDNA in each reaction, along with 2× TaqMan Fast Advance Master Mix (Thermo Fisher) and the following TaqMan primer probes: β-actin, NMI, CDH1, CDH2, KRT14, SNAI1, SNAI2, VIM, ZEB1, ZEB2 (Thermo Fisher).
RNA polymerase I (Pol I) transcription activity was quantitated by monitoring levels of 5′ external transcribed spacer (ETS) of the 47S pre-RNA using RT-PCR. cDNA (1:50 dilution) was used with 2× Maxima SYBR Green Master Mix (Thermo Fisher) along with the following primer sets to perform the reaction [25 (link)]:
Human 5′ETS 851–961 For-GAACGGTGGTGTGTCGTT, Rev-GCGTCTCGTCTCGTCTCACT; β-actin For-CATGTACGTTGCTATCCAGGC, Rev-CTCCTTAATGTCACGCACGAT.
Mouse 45S rRNA ITS1 For-CCGGCTTGCCCGATTT, Rev-GGCCAGCAGGAACGA; β-actin For-GGCTGTATTCCCCTCCATCG, Rev-CCAGTTGGTAACAATGCCATGT.
Applied Biosystems StepOnePlus Real-time PCR machine was used for the reactions (done in triplicate). Analysis was done using ^ΔΔCT to determine relative fold changes in mRNA or 5′ETS transcripts.

Metge B.J., Alsheikh H.A., Kammerud S.C., Chen D., Das D., Nebane N.M., Bostwick J.R., Shevde L.A, & Samant R.S. (2024). Targeting EMT using low-dose Teniposide by downregulating ZEB2-driven activation of RNA polymerase I in breast cancer. Cell Death & Disease, 15(5), 322.

+ Open protocol

+ Expand

Measuring DNA Damage Response Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were exposed to 4 Gy irradiation or treated with 2.5 µM NU7441 (DNA-PKcs i) or 5 µM KU-55933 (ATM i) 1 h prior to irradiation, followed by RNA extraction at times indicated post-irradiation, using the RNeasy Mini Kit (Qiagen, Hilden, Germany). All non-irradiated controls were collected in conjunction with the 1 h post-irradiated cells. cDNA was generated using 1 µg total RNA and the High Capacity cDNA kit (Thermo Fisher). Real-time PCR was performed using 40 ng total cDNA per reaction, 2× TaqMan Fast Advance Master Mix or Maxima 2X SYBR Green Master Mix (Thermo Fisher), and the following primers: TCOF1 For- CGG GAG CTA CTT CCC CTG AT; Rev- CAG AAG GGT TAC GGG CTG AG and ACTB For- CATGTACGTTGCTATCCAGGC; Rev-CTCCTTAATGTCACGCACGAT or TaqMan primer probes: β-actin or GLI1 (Thermo Fisher).
The rate of RNA Pol I transcription was measured by determining short-lived 5’ external transcribed spacer (5’ETS) rRNA of the 47S pre-RNA by real-time PCR. Reactions were performed with 2 µl of 1:50 diluted cDNA with 2× Maxima SYBR Green Master Mix (Thermo Fisher) along with the following primer sets (11)(11)(7)- 5’ETS 851–961 forward: GAACGGTGGTGTGTCGTT; reverse: GCGTCTCGTCTCGTCTCACT.
Reactions were run in triplicate using Applied Biosystems StepOnePlus Real-time PCR machine. Analysis was done using ^ΔΔCT to determine relative fold changes in mRNA or 5’ETS transcripts.

Metge B.J., Alsheikh H.A., Chen D., Elhamamsy A.R., Hinshaw D.C., Chen B.R., Sleckman B.P., Samant R.S, & Shevde L.A. (2023). Ribosome biosynthesis and Hedgehog activity are cooperative actionable signaling mechanisms in breast cancer following radiotherapy. NPJ Precision Oncology, 7, 61.

+ Open protocol

+ Expand

Quantitative mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA expression levels were determined using Taqman Fast Advance Master Mix (Applied Biosystems), 50 ng input cDNA, and TaqMan probes (Table S3). Samples were analysed using an Applied Biosystems QuantStudio 7 Flex Real‐Time PCR system with the following thermocycling program: (a) 95 °C for 20 s and (b) 40 cycles of 95 °C for 1 s, 60 °C for 20 s. Cycle threshold values of quantified transcripts were normalized to the cycle threshold of the hydroxymethylbilane synthase (Hmbs) control gene from the same sample.

Wiedner H.J., Torres E.V., Blue R.E., Tsai Y., Parker J, & Giudice J. (2022). SET domain containing 2 (SETD2) influences metabolism and alternative splicing during myogenesis. The Febs Journal, 289(21), 6799-6816.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After stimulation of macrophages, RNA was extracted by TRIzol (Invitrogen) and Direct-zol 96 RNA Preps (Zymo Research). cDNA was synthesized using random hexamer and TaqMan Reverse Transcription Reagents (Applied Biosystems). TaqMan Fast Advance Master mix and TaqMan Primer/Probe sets were used for qRT-PCR in ABI StepOne System (Applied Biosystems).

Lucarelli R., Gorrochotegui-Escalante N., Taddeo J., Buttaro B., Beld J, & Tam V. (2022). Eicosanoid-Activated PPARα Inhibits NFκB-Dependent Bacterial Clearance During Post-Influenza Superinfection. Frontiers in Cellular and Infection Microbiology, 12, 881462.

+ Open protocol

+ Expand

Gene Expression Analysis of Vibrational Stimulus

Check if the same lab product or an alternative is used in the 5 most similar protocols

SurePrep™ TrueTotal™ RNA Purification Kit (Fisher) was used to extract total RNA as per manufacturer’s instructions. RNA quantification at A₂₆₀ used to standardize amount RNA (10 ng/μL) loaded into High-Capacity RNA to cDNA kit cDNA for reverse transcription. One-tenth of the cDNA was subjected to qRT-PCR using TaqMan® Fast Advance Master Mix (Applied Biosystems) in conjunction with primer probes (ThermoFisher): human calpain-1 (Hs00559804_m1), E-cadherin (Hs01013958_m1) and GAPDH (Hs0392907_g1) in conjunction with a QuantStudio 5 Real-Time PCR instrument. Melt curves indicate the primer set produced one product. The ΔΔC_t method calculation was used for comparing expression levels between cells exposed to vibrational stimulus or not.

LaGier A.J., Elbe A., Thamke A, & Anderson P. (2022). Vibration, a treatment for migraine, linked to calpain driven changes in actin cytoskeleton. PLoS ONE, 17(4), e0262058.

+ Open protocol

+ Expand

Hepatocyte Marker Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Progenitor and ductal cell markers, leucine-rich repeat containing G protein-coupled receptor 5 (LGR5) and keratin 19 (KRT19), and differentiation markers (albumin, ALB; apolipoprotein B, APOB; and cytochrome P450 3A4, CYP3A4) were analyzed by RT-qPCR. Total RNA was extracted from organoids by using TriReagent (Sigma) and expression was also analyzed in HepG2 cells and control liver biopsy. cDNA was synthesized using Maxima First Strand cDNA Synthesis kit (Thermo Scientific, Fermentas Life Sciences, St. Leon-Rot, Germany). The RT-qPCR of selected hepatocyte markers was performed in triplicate using Taqman Fast Advance master mix (Applied BioSystems) and specific primers and probes (Supplementary Table 1). Taqman probes were from Universal probe library, UPL, (Roche): KRT19 (#71), LGR5 (#78), ALB (#44), APOB (#90), CYP3A4 (#50). Amplification conditions were as follows: 95 °C for 20 s, 45 denaturation cycles at 95 °C for 3 s, annealing at 60° C for 30 s. RT-qPCR was performed on the QuantStudio 5 System (ThermoFisher Scientific) and the analysis using the software QuantStudio Design and Analysis Software v1.4.3. Glyceraldehyde-3-phosphate dehydrogenase (GADPH) was used as an endogenous control. The relative gene expression was calculated by comparative Ct method and obtaining the fold-change value (DDCt).

Gómez-Mariano G., Matamala N., Martínez S., Justo I., Marcacuzco A., Jimenez C., Monzón S., Cuesta I., Garfia C., Martínez M.T., Huch M., Pérez de Castro I., Posada M., Janciauskiene S, & Martínez-Delgado B. (2019). Liver organoids reproduce alpha-1 antitrypsin deficiency-related liver disease. Hepatology International, 14(1), 127-137.

+ Open protocol

+ Expand

Quantification of LUPDCT Transcripts in Flax

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantification of LuPDCT1 or LuPDCT2 transcripts in various flax tissues was performed using 7.2 μL of a 1/40 dilution of cDNA as template with Taqman Fast Advance Master Mix (Applied Biosystems, http://www.appliedbiosystems.com) in a final volume of 25 μL. Primers (300 nM) and Taqman probes (10 nM) were designed to specifically anneal to LuPDCT1, LuPDCT2, or the two reference genes, GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE (GAPDH) and UBIQUITIN EXTENSION PROTEIN (UBI2), which have been shown previously to be expressed stably in flax [44 (link)] (for sequences, see Additional file 1: Table 3). PCR efficiencies for each primer pair were calculated using a dilution series of a single cDNA sample over several log concentrations. All reactions were carried out using the ABI PRISM 7900 HT Real Time PCR system (Applied Biosystems) with the following thermal parameters: 50°C for 2 min, 95°C for 20 s and 40 cycles of 95°C for 1 s and 60°C for 20 s. Primer specificity was verified by separating resulting qRT-PCR amplicons on a 2% agarose gel. Relative levels of LuPDCT1 or LuPDCT2 transcripts were calculated using the comparative Ct method after normalizing to the two reference genes. The average of three biological and technical replicates, respectively, was used to denote transcript abundance in each case.

Wickramarathna A.D., Siloto R.M., Mietkiewska E., Singer S.D., Pan X, & Weselake R.J. (2015). Heterologous expression of flax PHOSPHOLIPID:DIACYLGLYCEROL CHOLINEPHOSPHOTRANSFERASE (PDCT) increases polyunsaturated fatty acid content in yeast and Arabidopsis seeds. BMC Biotechnology, 15, 63.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA from mouse liver, spleen, and aorta was extracted using Trizol (Invitrogen, Carlsbad, CA). To obtain cDNA, reverse transcription was performed using MultiScribe Reverse Transcriptase (Applied Biosystems, Foster City, CA), a recombinant mouse Maloney leukemia virus reverse transcriptase. TaqMan Fast Advance Master Mix (Applied Biosystems) or SYBR Select Master Mix (Applied Biosystems) was used to perform quantitative PCR. TaqMan assays were used for 18S ribosomal RNA and hepcidin mRNA. Forward and reverse primer sequences for CD68 were 5’-CGATGCCCTGCCAATCGAGATGCTGG-3’ and 5’-CCCGGGGAGCATGTCAAGGTCAAAATCG-3’, respectively. Real-time amplification and quantification of transcripts was performed using a Mastercycler Realplex (Eppendorf, Hamburg, Germany). The expression of target genes was determined using the relative C_T method and values were normalized to levels of 18S ribosomal RNA.

Malhotra R., Wunderer F., Barnes H.J., Bagchi A., Buswell M.D., O’Rourke C.D., Slocum C.L., Ledsky C.D., Peneyra K.M., Sigurslid H., Corman B., Johansson K.B., Rhee D.K., Bloch K.D, & Bloch D.B. (2019). Hepcidin Deficiency Protects Against Atherosclerosis. Arteriosclerosis, thrombosis, and vascular biology, 39(2), 178-187.

+ Open protocol

+ Expand

Quantifying HIV-1 Reservoir by RT-qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD4⁺ T cells (1×10⁶) from ART or ART+GYY4137 treated groups were harvested to isolate total RNA using Qiagen RNAeasy isolation kit and 200 ng of total RNA was reverse transcribed (iScript cDNA synthesis kit, Bio-Rad). Reverse transcribed cDNA was diluted tenfold and amplified using primers against HIV-1 LTRs and seminested—PCR was performed using primers and probe listed in Supplementary file 1f. Serially diluted pNL4.3 plasmid was used to obtain the standard curve. Isolation and RT-qPCR of total HIV-1 DNA were performed as described earlier (Kessing et al., 2017 (link)). Briefly, 1×10⁶ cells were lysed (10 mM Tris-HCl, 50 nM KCl, 400 mg/ml proteinase K) at 55°C for 16 hr followed by inactivation at 95°C for 5 min. Digested product was used as a template to set up the first PCR with Taq polymerase (NEB), 1× Taq buffer, dNTPs, HIV-1 and CD3 primers for 12 cycles. The second-round amplification was done using seminested PCR strategy wherein tenfold dilution of first round PCR product was used as a template, HIV-1, and CD3 primers/probes, Taqman Fast Advance master mix (Applied Biosystems) using SetupOnePlus Real-time PCR system (Applied Biosystems). DNA isolated from ACH2 cells that contain a single copy of HIV-1 per cell was used to obtain standard curve.

Pal V.K., Agrawal R., Rakshit S., Shekar P., Murthy D.T., Vyakarnam A, & Singh A. (2021). Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasis. eLife, 10, e68487.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using Trizol reagent and purified in accordance with the manufacturer’s instructions (Life Technologies). RNA quantification and quality were assessed using a Nanodrop system. The Superscript III reverse transcription kit (Life Technologies) was employed to prepare the cDNA. qPCR was performed with TaqMan Fast Advance Mastermix and the appropriate primer pair (Applied Biosystems) and analyzed using a Roche LightCycler 480 real-time PCR system. Gene expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and expressed as relative expression over the control sample (hESC on day 0 of differentiation). qPCRs were performed in triplicate. Data analysis was performed using Roche LightCycler 480 software (version 1.5). Levels of significance were measured by Student’s t test and defined as p < 0.05.

Cameron K., Tan R., Schmidt-Heck W., Campos G., Lyall M.J., Wang Y., Lucendo-Villarin B., Szkolnicka D., Bates N., Kimber S.J., Hengstler J.G., Godoy P., Forbes S.J, & Hay D.C. (2015). Recombinant Laminins Drive the Differentiation and Self-Organization of hESC-Derived Hepatocytes. Stem Cell Reports, 5(6), 1250-1262.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!