RNA was extracted from Hepa1-6 cells using TRIzol Reagent (Invitrogen) according to the manufacturer's protocols. A PrimeScript® II 1st strand cDNA Synthesis kit (Takara) was used to synthesize the cDNA, and then, gpc3 was amplified using a Takara PCR amplification kit. The following primers were used: gpc3-Bam H I-forward: 5′-AGGATCCATGGCCGGGACCGTGCGCACC GCGT- 3′, gpc3-Xba I-2×Flag-reverse: 5′-GGTCTAGAGAGAC CTTACTTATCGTCGTCATCCTTGTAATCCTTATCGT CGTCATCCTTGTAATCGTGCACCAGGAAAAAAAA GCACGCC-3′. For homologous recombination, the gpc3 gene was introduced into the genome of P.y-WT using a pL0017 plasmid by electroporation as previously described [58 (link)]. Pyrimethamine (Sigma) was used to select and clone Pyrimethamine-resistant parasites in mice. Parasite genomic DNA was extracted using the DNeasy blood & tissue kit (QIAGEN). The integration of the exogenous gene into the parasite genome was confirmed by PCR analysis of parasite genomic DNA. GPC3 expression in parasites was detected with western blotting [42 (link)] and confocal microscopy (Leica) [59 (link)]. Monoclonal anti-Flag@M2 antibody (Sigma, mouse, #088K6018) was used for western blot and detailed data about other antibodies involved in this experiment were mentioned previously.
Pyrimethamine
Manufactured by Merck Group
Sourced in United States, Germany, China, Brazil
Pyrimethamine is a pharmaceutical compound that functions as an antiparasitic agent. It is commonly used in the laboratory setting for research purposes.
Automatically generated - may contain errors
Lab products found in correlation
Dimethyl sulfoxide (dmso), by Merck Group (9 mentions)
Sulfadiazine, by Merck Group (7 mentions)
Chloroquine, by Merck Group (7 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (6 mentions)
Chloramphenicol, by Merck Group (5 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Mycophenolic acid, by Merck Group (4 mentions)
Trimethoprim, by Merck Group (4 mentions)
Nucleospin blood quickpure kit, by Macherey-Nagel (3 mentions)
Methotrexate, by Merck Group (3 mentions)
Gentamicin, by Thermo Fisher Scientific (3 mentions)
Hypoxanthine, by Merck Group (3 mentions)
Alexa fluor 488, by Thermo Fisher Scientific (3 mentions)
Moflo cell sorter, by Agilent Technologies (2 mentions)
Gotaq flexi dna polymerase, by Promega (2 mentions)
Mefloquine, by Merck Group (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Trimetrexate, by Bio-Techne (2 mentions)
Artesunate, by Merck Group (2 mentions)
Xanthine, by Merck Group (2 mentions)
100 protocols using pyrimethamine
1
Genetic engineering of Plasmodium parasite
2
Confirming Parasite Gene Essentiality via CRISPR Knockouts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We selected 11 genes from the 85 hits from the genome-wide screen based on the following criteria: RPKM >20, ToxoDB phenotype score > 0. From that list of 43 genes, we mostly picked genes encoding for dense granule proteins but also added some random non-secretory genes. To confirm these 11 hits identified from the screen, RH-Cas9 (wild-type) and RH-Cas9Δgra17 (Δgra17) parasites were transfected with 2 plasmids, each containing a different sgRNA targeting the 11 genes under investigation. Immediately after transfection plaque assays were performed by adding 5,000 parasites into 3 wells of a 6-well plate with HFFs in the presence of 1 μM pyrimethamine (Sigma–Aldrich, Cat#46706) (the plasmid contains a pyrimethamine resistance cassette). Plaque numbers were determined 8 days p.i. As a negative control, we used sgRNAs targeting SAG1, of which the knockout has no phenotype in either background, while as positive controls we used sgRNAs targeting GRA23 (TGGT1_297880), which is synthetically lethal with GRA17 but of which the knockout has no growth effect in wild-type [4 (link)]. sgRNAs targeting CDPK1 (TGGT1_301440, phenotype score = -3.3), which was previously shown to be essential in RH [23 (link)], and TGGT1_223440 (phenotype score = -3.6 [24 (link)]) were used as the control for genes important for fitness in both wild-type and Δgra17 parasites.
3
Drug Preparation for Villous Explant Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Azithromycin (Biofarma, Uberlândia, MG, Brazil), spiramycin (Sigma) and a drug combination (PS) consisting of pyrimethamine (Sigma) and sulfadiazine (Sigma) were dissolved in DMSO (stock solution) to a concentration of 10,000 μg/mL for Azithromycin, spiramycin, sulfadiazine and 3000 μg/mL for pyrimethamine. Stock solutions were freshly reconstituted and different drug concentrations were used for the treatment of villous explants.
4
CRISPR-based Genetic Modification of P. knowlesi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tightly synchronized mature schizont-stage parasites of P. knowlesi were transfected using the Amaxa 4D electroporator (Lonza, Basel, Switzerland) and the P3 Primary cell 4D Nucleofector X Kit L (Lonza) following previous reports (Moon et al., 2016 (link)). Briefly, a 20-μg repair template and 20 μg pCas9/sg (Mohring et al., 2019 (link)) containing sgRNA sequences for pkmsp1p were mixed with P3 Primary Cell nucleofector solution, including supplement 1 (Lonza), and transferred to a Nucleocuvette™ Vessel (Lonza), followed by nucleofection with program FP158. Transfected parasites were immediately transferred to complete media with RBCs and incubated at 550 rpm for approximately 30 min at 37°C to allow invasion before transferring to standard culture conditions. After 24 h, transfected parasites were selected by drug pressure with 100 nM pyrimethamine (Sigma-Aldrich), and the medium, including pyrimethamine, was replaced at daily intervals for 5 days. The transfected parasites were cloned out by limiting dilution and confirmed by genotyping with diagnostic primers of extracted genomic DNA (Supplementary Tables 1 2
5
Auranofin, Pyrimethamine, and Sulfadiazine Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Auranofin (Enzo Life Sciences), was dissolved in 100% ethanol as a stock solution (4 mg/mL) and then diluted in complete tissue culture medium (DMEM +2% FBS) for final concentrations of 0.1 to 19 µM. For in vivo experiments, the Auranofin concentration used was 1 mg/kg of estimated body weight.
Pyrimethamine (Sigma Aldrich) was dissolved in 100% ethanol in a stock concentration of 5 mg/mL. Three final dilutions in complete tissue culture medium were examined: 0.02, 0.1 and 0.2 µM. Sulfadiazine (Sigma Aldrich) was dissolved in complete medium at a final stock concentration of 5 mg/mL. Three doses in complete medium were evaluated: 0.2, 1 and 2 µM. Testing of Pyrimethamine/Sulfadiazine combinations by checkerboard method (using abovementioned concentrations) was carried out in triplicates and in three independent experiments.
Pyrimethamine (Sigma Aldrich) was dissolved in 100% ethanol in a stock concentration of 5 mg/mL. Three final dilutions in complete tissue culture medium were examined: 0.02, 0.1 and 0.2 µM. Sulfadiazine (Sigma Aldrich) was dissolved in complete medium at a final stock concentration of 5 mg/mL. Three doses in complete medium were evaluated: 0.2, 1 and 2 µM. Testing of Pyrimethamine/Sulfadiazine combinations by checkerboard method (using abovementioned concentrations) was carried out in triplicates and in three independent experiments.
6
Pyrimethamine Treatment for Malaria Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Starting at day 5 p.i., one group of PbA-infected mice was treated with the anti-malarial drug pyrimethamine (Sigma–Aldrich, Germany). 25 mg of pyrimethamine was dissolved in 1 ml of dimethyl sulfoxide (DMSO; Sigma–Aldrich, United Kingdom). 50 μl of this solution was dissolved with 950 μl of PBS (Gibco, United Kingdom) to make a working concentration of 1.25 mg/ml. pyrimethamine was administered intravenously (i.v.) into mice (0.125 mg in 100 µl/mouse). The other group received phosphate-buffered saline (PBS) as control and has been referred to as untreated mice.
7
Stable Transfection of Eimeria spp.
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The constructed plasmids, linearized with SnaBI, were transfected into 1 × 107 EacWT or EteWT sporozoites by restriction enzyme-mediated integration as previously described39 (link). After nucleofection (Program U-033, AMAXA, Switzerland), the transfected E. tenella sporozoites were inoculated into the ileocecal opening via the cloaca, and the transfected E. acervulina sporozoites were inoculated intravenously into the wing vein of five 1-week-old chickens equally for stable transfection23 (link). The transgenic oocysts were selected in chickens by the MoFlo® Cell Sorter (Dako-Cytomation, Fort Collins, CO) on the single-cell mode in vitro, and/or 150 mg/L pyrimethamine (Sigma-Aldrich Co., St. Louis, Mo., USA) press by drinking water in vivo, then inoculated into coccidian-free chickens for the propagation of next generation oocysts.
8
Preparation and Use of Amitozyn Drug
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The semi-synthetic drug amitozyn was prepared as described previously at a concentration of 25 mg/mL [15 (link)]. CQ, pyrimethamine, ART, monoclonal mouse anti-α-tubuline (T9026), and polyclonal anti-γ-tubuline antibodies (T3559) were purchased from Sigma. Advanced RPMI Medium 1640, Alexa Fluor 488 goat anti-mouse and Alexa Fluor 594 goat anti-rabbit antibodies were from Invitrogen. 4′,6-Diamidino-2-phenylindole, dihydrochloride (DAPI) and LDH cytotoxicity kit were from Termo Scientific Pierce. EGM-2 medium was from Lonza. The polyclonal rabbit anti-human RBC antibodies were from Rockland. Human blood O+ and AB human serum were purchased from Valley Biomedical.
Human HeLa, KB3, HT29, HCT116, A549, IMR90, HUVEC, MESSA, and murine B16, GL26 and COS7 cell lines were purchased from ATCC. HCT116 p53(−/−) cells with homozygous knock-out of p53 were kindly provided by Dr D Skoufias (IBS, Grenoble, France). Taxol-resistant A549T12 cells were obtained with permission from Dr S Horwitz (Albert Einstein College of Medicine, New York, NY, USA). The MESSA Dx5 cells were kindly provided by Dr L Lafanechère (CNRS, UMR 5168/CEA/IRTSV, Grenoble, France).
Human HeLa, KB3, HT29, HCT116, A549, IMR90, HUVEC, MESSA, and murine B16, GL26 and COS7 cell lines were purchased from ATCC. HCT116 p53(−/−) cells with homozygous knock-out of p53 were kindly provided by Dr D Skoufias (IBS, Grenoble, France). Taxol-resistant A549T12 cells were obtained with permission from Dr S Horwitz (Albert Einstein College of Medicine, New York, NY, USA). The MESSA Dx5 cells were kindly provided by Dr L Lafanechère (CNRS, UMR 5168/CEA/IRTSV, Grenoble, France).
9
Cell Proliferation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nitrofurantoin and pyrimethamine were purchased from Sigma-Aldrich Chemical Co. (St. Louis, Missouri, USA). The CellTiter 96 AQueous One Solution Cell Proliferation Assay kit was purchased from Promega Corporation (Madison, Wisconsin, USA). All the sera, antibiotics, and RPMI 1640 for cell culture were obtained from Invitrogen (Grand Island, New York, USA). All the chemicals were of reagent grade.
10
Myrislignan Bioactive Compound Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Myrislignan ([erythro-(1R,2S)-2-(4-allyl-2,6-dimethoxyphenoxyl)-1-(4-hydroxy-3-methoxyphenyl) propan-1-ol], batch number DST180502-043) was purchased from Desite Biotechnology Co., Ltd. (Chengdu, China) and had a purity greater than 99%. For the in vitro experiments, myrislignan was dissolved in dimethyl sulfoxide (DMSO, Sigma, USA) to a concentration of 25 mg/ml and diluted in DMEM containing 1% FBS to different concentrations. Sulfadiazine (Sigma, USA), which was used as positive control drug, was dissolved in DMEM with 1% FBS to a concentration of 0.4 μg/ml. For the in vivo experiments, myrislignan was dissolved in solvent 1 (isotonic saline containing 5% ethanol and 5% Cremophor EL) to concentrations of 5 or 10 mg/ml. Sulfadiazine (10 mg/ml), pyrimethamine (5 mg/ml, Sigma, USA), and folinic acid (1.5 mg/ml, Sigma, USA) were suspended in physiological saline containing 1% CMC-Na (solvent 2) and used as a positive control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!