Universal mycoplasma detection kit

U-2OS, HCT116, RPE1 and 293T cells were cultured in Dulbecco’s modified medium supplemented with 10% fetal calf serum, 1% penicillin/streptomycin and 1% non-essential amino acids. HCT116-ETAA1ΔAAD-TOPBP1-mAID, a kind gift from David Cortez, was cultured in Dulbecco’s modified medium supplemented with 10% fetal calf serum, 1% penicillin/streptomycin and 1% non-essential amino acids. U-2OS-SEC (stably expressing inducible Cas9) clones were generated by lentiviral infection with TLCV2 vector (a kind gift from Adam Karpf, Addgene plasmid #87360) followed by puromycin selection (1 μg/ml). HCT116-dCas9-VP64 clones were generated by lentiviral infection with the pHAGE EF1α dCas9-VP64 vector (a kind gift from Rene Maehr and Scot Wolfe, Addgene plasmid #50918) followed by puromycin selection (1 μg/ml). U-2OS-shSCRAMBLE and U-2OS-sh53BP1 were generated by lentiviral infection with pLKO.1 derivative plasmid followed by puromycin selection (1 μg/ml).
shSCRAMBLE.FOR: CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG.
shSCRAMBLE.REV: AATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG.
sh53BP1.FOR: CCGGGATACTCCTTGCCTGATAATTCTCGAGAATTATCAGGCAAGGAGTATCTTTTTG.
sh53BP1.REV: ATTCAAAAAGATACTCCTTGCCTGATAATTCTCGAGAATTATCAGGCAAGGAGTATC.
All the cell lines were regularly tested for mycoplasma contamination with the Universal Mycoplasma Detection Kit (ATCC).

Uninfected and A. phagocytophilum NCH-1 strain–infected human promyelocytic HL-60 cells (CCL-240; American Type Culture Collections [ATCC]) and RF/6A rhesus monkey choroidal endothelial cells (CRL-1780; ATCC) were cultured as previously described (Huang et al, 2010a (link)). HeLa human cervical epithelial cells (CCL-2; ATCC) were maintained as described (Justis et al, 2017 (link)). C. burnetii Nine Mile Phase II (NMII; clone 4, RSA439) and mCherry-C. burnetii NMII were purified from Vero cells (African green monkey kidney epithelial cells; CCL-81; ATCC) or acidified citrate cysteine medium-2 (ACCM-2) and stored as described (Cockrell et al, 2008 (link); Beare et al, 2009 (link)). Mouse alveolar macrophages (MH-S; CRL-2019; ATCC) and THP-1 human monocytic cells (TIB-202; ATCC) were maintained as described (Mulye et al, 2018 (link)). THP-1 cells were differentiated into macrophage-like cells by overnight treatment with 200 nM phorbol 12-myrisate 13-acetate (MilliporeSigma). C. trachomatis serovar L2 (LGV 434) was maintained in HeLa cells at 37°C as described (Rucks et al, 2017 (link)). C. pneumoniae AR39 was maintained in HeLa cells at 35°C as described (Ouellette et al, 2016 (link)). Mammalian cell cultures were low passage and confirmed to be mycoplasma free using the Universal Mycoplasma Detection kit (ATCC) or Mycoplasma PCR Detection kit (MilliporeSigma).

All reagents were of American Chemial Society (ACS) or higher purity and were purchased from Thermofisher or Sigma unless specified below. Cy5-DBCO, Cy5-N-hydroxysuccinimide (NHS), DBCO-(PEG)₄-NHS ester and sulfo DBCO-(PEG)₄-maleimide, and DBCO-magnetic beads were purchased from Click Chemistry Tools. Cell lines (BT474 and LS174T) were obtained from ATCC, validated by flow cytometry, and tested monthly to ensure they were free of mycoplasma contamination (Universal Mycoplasma Detection Kit from ATCC).

MDA-MB-231, MDA-MB-468, and BT-549 cells were obtained from ATCC (Manassas, VA). MDA-MB-231 and MDA-MB-468 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) with 10% serum and Pen-Strep Glutamine and BT-549 were grown in RPMI-1640 + 10%PBS + Insulin (1 μg/ml). Cells were checked every 2 months for the presence of mycoplasma by a polymerase chain reaction (PCR) based method using a Universal Mycoplasma Detection Kit (30–1012K; ATCC, Manassas, VA). Only mycoplasma negative cells were used in this study. Cell lines were made to stably express GFP by lentiviral transduction and labeled as 231-GFP, 468-GFP, or BT-549-green fluorescent protein (GFP).

Human colon adenocarcinoma cells (HT29; ATCC cell culture collection, Monassas, VA, USA) were grown in Smart cell incubator (Heal Force; 37 °C, 5% CO₂). McCoy’s medium supplemented with L-glutamine (2 mol/L), sodium pyruvate (200 g/L), fetal bovine serum (100 mL/L), and antibiotics (10,000 U/mL penicillin and 100 g/L streptomycin) were used as suggested by ATCC. Cultured cells were regularly checked for mycoplasma contamination by the use of universal Mycoplasma Detection Kit (ATCC, Monassas, VA USA). Cells were used for the determination of various biological activities of tested berry fruit extracts.